SteamHistory
Alias SearchAvatar SearchURL SearchBulk SearchAPIComment SearchMulti-Source Search
[ Supporter Features ]
Alias SearchAvatar SearchURL SearchBulk SearchAPIComment SearchMulti-Source Search
[ Supporter Features ]
[ Supporter Features ]
[ Supporter Features ]
SteamID64: 76561198140963301
SteamID32: [U:1:180697573]
SteamID: STEAM_0:1:90348786
CommunityURL: https://steamcommunity.com/id/crazychemist_2/
ProfileURL: https://steamcommunity.com/profiles/76561198140963301
Status: Offline
Privacy: Public
Profile Setup: True
Premium: True
Creation: 2014-06-17 11:56:14 (GMT)
Last Updated: 2023-09-04 19:39:33
VAC Banned: False
Community Banned: False
Game Banned: False
Trade Banned: False
| Name | Time Changed |
|---|---|
| cam | 2023-04-01 02:53:25 [Estimated] |
| RealName | Time Changed |
|---|---|
| 🏴 Catalonia | 2023-04-01 02:53:25 |
| URL | Time Changed |
|---|---|
| https://steamcommunity.com/id/crazychemist_2/ | 2023-04-01 02:53:25 |
| State | Time Changed |
|---|
| Commenter | Message | Timestamp |
|---|---|---|
| MrBombek | +REPSiema, dodaj prosze, mam pytanie | 2024-06-19 03:30:50 |
| ^VEXλRiE.# ( ͡° ͜ʖ ͡°) | agrégame calvo | 2024-06-07 18:05:02 |
| puppypuncher69 | -rep loves women | 2024-06-06 21:36:31 |
| cam | i dont think women are retarded wtf i love women | 2024-06-04 09:40:43 |
| Bronnie | -rep thinks he's better than the bear and thinks women are retarded | 2024-06-02 15:21:37 |
| _LuckyLife_ #casehug | Be carefully our guy i mean the letter 3 is going to hack you | 2024-05-30 22:15:01 |
| ✿ The Letter 3 ♡ | oh, so this is where all u losers ♥♥♥ from...... can't say im surprised. | 2024-05-27 16:23:32 |
| photostel 乡 | Bitaxe the planet! | 2024-05-26 10:10:59 |
| ¡ṇ̤͛̒̍ẹ̿͋̒̕o̯̊͢ | check your walls | 2024-05-26 08:58:38 |
| cam | it's so over cambros...... | 2024-05-26 06:50:11 |
| photostel 乡 | ye. I officially step down from my steamcity LARP career a full list of all my alt accounts will be published soon, but here's some easy ones people already guessed anyway:- rozz synthclair- deiv- fadingvapes- quesadilla- doffy- davidcito- ain- AHN- at least 85% of the WHO's | 2024-05-24 15:40:29 |
| nerdError | no u | 2024-05-20 18:00:43 |
| ✿ The Letter 3 ♡ | guess I shut you up. Now one more time, stay your fqn as.s off my profile. | 2024-05-19 17:08:41 |
| opta | Optagonus Estuvo Aqui | 2024-05-13 17:47:20 |
| cam | xanaxeater1 depressiveparanoidfreak Latvia | 2024-05-13 10:02:49 |
| xanaxeater1 | Дегенерат который не понимает как играть в игру, пытался заруинить со своим полоумным другом но пожрали говна и мы выиграли | 2024-05-12 12:14:54 |
| The Letter 3 ♡ | Not only are u a loser, ur gay too. sick fq. | 2024-05-04 18:06:10 |
| The Letter 3 ♡ | spanish speaking fq. I knew u were trash. | 2024-05-03 18:38:35 |
| 34 | camara nunca haría eso <3 | 2024-05-01 10:48:33 |
| cam | gracias 34 se me ocurrio a mi solo y desde luego no se lo copié a un niño polaco con el que jugue cs hace unos meses | 2024-05-01 09:59:06 |
| 34 | buen perfil camara | 2024-04-29 17:11:23 |
| cam | The Letter 3 ♡ | 2024-04-23 04:06:11 |
| cam | hi | 2024-04-18 11:51:54 |
| blessed | cameraman | 2024-04-18 09:08:41 |
| BearGoesRawr | v dude added me just to say this and then deleted me lol what is wrong with you? | 2024-04-16 21:18:30 |
| BearGoesRawr | [8:21 PM]cam:its so weird i think im starting to develop a thing for this letter 3 guy | 2024-04-16 21:17:21 |
| Hitiano | marico | 2024-04-14 15:24:08 |
| cam | no I jack off to cunny | 2024-04-14 10:54:50 |
| cam | I didn't understand, please use proper english next time | 2024-04-08 08:54:41 |
| cam | I will never stay out of your profile | 2024-04-05 03:35:16 |
| The Letter 3 | fqn bch as.s. stay the fq out of my profile or I will locate you. | 2024-04-04 19:59:50 |
| | ㅤ | 2024-04-01 08:30:54 |
| cam | dont tilt me brother | 2024-03-31 20:00:08 |
| Arttu Wiskari | sad ragebaiter | 2024-03-31 19:43:25 |
| | ㅤ | 2024-03-31 15:56:14 |
| lunky | Can you eat me out | 2024-03-30 16:33:40 |
| JOJOJOJOJOJOJOJOJOJOJOJOJOJOJOJO | Professional AK-47 safari mesh FT 0.27 pattern 401 owner, Gerona | 2024-03-30 15:56:44 |
| cam | que te calles, marrón | 2024-03-30 14:30:57 |
| JOJOJOJOJOJOJOJOJOJOJOJOJOJOJOJO | eso deberia preguntarte yo que despues de dos tres dias me plantas el copia pega yo solo te respondo españolito | 2024-03-30 13:52:35 |
| cam | cuántas veces piensas en mí cada día? | 2024-03-30 12:59:20 |
| JOJOJOJOJOJOJOJOJOJOJOJOJOJOJOJO | Hospitalet de Llobregat, Maroc | 2024-03-30 12:54:39 |
| cam | stfu Onirocrisia 𝄞 | 2024-03-29 14:12:59 |
| ∅nirocrisia 𝄞 | sorry uh.. but did you just.. like.. talk to me? like you actually think you can j-..? ew.. why are yo.. actually nvm i dont wanna know.. this is making me feel sick.. i'm leaving now.. | 2024-03-29 14:08:38 |
| 登记的性犯罪者 | Onirocrisia you just got owned. I'd deactivate account after that | 2024-03-29 13:31:14 |
| cam | check inventory i don't have any spare change get out of my profile broke ass nigga | 2024-03-29 13:27:23 |
| ∅nirocrisia 𝄞 | I'd give you a job. | 2024-03-29 13:23:48 |
| 登记的性犯罪者 | bau bello | 2024-03-27 13:33:06 |
| photostel 乡 | Now, I am under attack by the biggest force in military history. Obama wants to kill me, to take away the freedom of our country, to take away our free housing, our free medicine, our free education, our free food, and replace it with American style thievery called “capitalism”, but all of us in the Third World know what that means, it means corporations run the countries, run the world, and the people suffer.So, there is no alternative for me, I must make my stand, and if Allah wishes, I shall die by following His path, the path that has made our country rich with farmland, with food and health, and even allowed us to help our African and Arab brothers and sisters.I do not wish to die, but if it comes to that, to save this land, my people, all the thousands who are all my children, then so be it. | 2024-03-26 14:39:36 |
| cam | verda | 2024-03-26 12:30:08 |
| MЯ ✞ | bastante inutil la verda | 2024-03-26 12:19:40 |
| cam | una coma en toda la biblia esa que me has dedicado, desde luego eres el españolito más listo | 2024-03-25 19:31:04 |
| JOJOJOJOJOJOJOJOJOJOJOJOJOJOJOJO | dices these spaniards como si no fueras de cataluña amigo te recomiendo que dejes las pastillas de estrogenos y salgas a limpiar las calles de tu querido pais calatuña que esta lleno de M aunque seguro que miras para el suelo como un corderito cada vez que te cruzas con alguno espero que se te pase esta etapa rebelde tuya te deseo lo mejor y aceptame el trade que le quiero poner eso ak mia va, eres camarero y eres quimico pero bueno una cosa va con la otra | 2024-03-24 20:31:08 |
| JOJOJOJOJOJOJOJOJOJOJOJOJOJOJOJO | Gerona, España | 2024-03-24 20:14:20 |
| JOJOJOJOJOJOJOJOJOJOJOJOJOJOJOJO | 4.2k horas hard stucked nivel 3 jjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjj | 2024-03-24 19:43:54 |
| pokercito739 | tre lauro novaintainueve pisha | 2024-03-21 16:33:01 |
| cam | i have 3,39 euros on my steam wallet | 2024-03-21 16:28:37 |
| The Letter 3 | what kind of stupid comment is that to leave on my profile? do you know how fqing pathetic it is that u took the time to post all that bs? u need a life. | 2024-03-19 19:37:44 |
| pokercito739 | https://youtu.be/Fau1CKy3sAU?si=VUgVXcGlf40Be-Z6 | 2024-03-19 14:26:33 |
| cam | do you think about me when you jerk off | 2024-03-17 17:06:46 |
| The Letter 3 | stay the fq off my profile you sick fq. | 2024-03-16 12:48:05 |
| cam | Be honest matt how many times do you think about me daily | 2024-03-12 04:53:09 |
| The Letter 3 | stay off my profile u c.0.q sucker. u and this grand child fantasy you keep bringing up. Idk if you are sick or damaged mentally. | 2024-03-10 19:48:03 |
| The Letter 3 | What are you talking about with grandsons? are you missing half your brain? | 2024-03-10 14:29:50 |
| cam | don't you have a grandson to take care of or something | 2024-03-09 18:59:58 |
| The Letter 3 | what a pathetic profile u have.... I bet you are some slant eye g0.0.k. | 2024-03-09 00:04:24 |
| cam | rasist bastard -4 reddit karma for you | 2024-03-08 19:30:35 |
| configs = you are bad | lmao, his bro has to defend him in his own comment | 2024-03-08 12:40:59 |
| 登记的性犯罪者 | wahh wahhh wahhh | 2024-03-08 12:39:50 |
| Pasix | -rep small wiener club member | 2024-03-08 12:16:52 |
| 登记的性犯罪者 | based | 2024-03-08 12:07:15 |
| configs = you are bad | -rep rasist bastard | 2024-03-08 12:05:38 |
| The Letter 3 | was only a matter of time before your bch as.s came crawling back to my profile. sad fq. | 2024-03-01 18:48:34 |
| cam | ok | 2024-02-28 14:41:00 |
| iSaaKuZ | Giverep+ toxic player :) | 2024-02-27 18:45:35 |
| Coal Shoveler | Now that's the sign of a omega ♥♥♥ | 2024-02-26 18:37:50 |
| cam | hola | 2024-02-26 06:06:06 |
| Hel | hentai vs furries | 2024-02-26 04:16:01 |
| so tru | cam | 2024-02-20 03:33:31 |
| Coal Shoveler | gay for commie c0ck you are | 2024-02-20 00:05:08 |
| pokercito739 | help me stepbro im stuck | 2024-02-19 18:33:21 |
| TAFF mom killedh3rself | based | 2024-02-19 17:38:11 |
| pokercito739 | How do I tell google Images I'm not interested in seeing black people. Is there a filter or something I need to enable.? | 2024-02-10 06:14:28 |
| cam | ok but first please fix your ♥♥♥♥♥♥♥ teeth. this is unbearable. | 2024-01-27 17:17:59 |
| | i will eat your leftist ass like corn on the cob | 2024-01-27 09:16:10 |
| cam | h | 2024-01-27 08:51:30 |
| pokercito739 | wdym im your lil bih? | 2024-01-24 13:49:29 |
| Brad Chadley | 🚨 ATTENTION EVERYONE 🚨🚨 PLEASE LISTEN CAREFULLY 🚨THIS RIGHT HERE IS MY GIRLFRIEND, SHE IS THE LOVELIEST PERSON IVE EVER MET AND I CANNOT THINK OF ANYTHING OR ANYONE ELSE THAT MAKES ME SMILE LIKE SHE DOESI LOVE HER SO MUCH AND SHE LOVES ME MORE IN RETURN, I COULD NEVER EVER EVEN IN MY MOST AMBITIOUS DREAMSSHE IS THE ONE AND TRUE LOVE OF MY LIFE AND THERE IS NOTHING I WOULD EVER MISS WITH HER, I LOVE HER SO MUCH💞💞💞💞💞💞💞💞💞💞💞💞💞💞💞💞💞💞💞💞💞 | 2024-01-24 07:39:11 |
| cam | h | 2024-01-23 04:38:50 |
| shy | i kill you!! i ♥♥♥♥ you like dog!! | 2024-01-22 23:16:39 |
| Rozz Synthclair | I'm very trustworthy. I promise the knife is just for cutting bread. | 2024-01-22 21:14:17 |
| shy | any real friend of mine would know its not spelt with a capital w :/ fake friend much? | 2024-01-22 15:26:08 |
| Rozz Synthclair | Hi, Woomzy! 3 years friendship anniversary in 8 months! Don't forget it!!! (I certainly won't.) | 2024-01-22 14:08:55 |
| shy | gay guy much? | 2024-01-21 19:25:42 |
| cam | you're nothing but a dog. show me jerking off pics and we'll talk. | 2024-01-20 18:41:07 |
| briiibaby | ewwwww | 2024-01-20 16:26:58 |
| cam | Ladies one at a time please | 2024-01-20 14:05:56 |
| briiibaby | im jerjGkIng off gim me a miunaiyute | 2024-01-19 17:46:12 |
| shy | u dont even remeber how u made me cry beg u to love me on vc. do u even care? | 2024-01-19 16:46:34 |
| Onirocrisia 𝄞 | can you please stop spamming my DM's with that "loli" stuff? Idc if it's "just cartoons" and "not hurting anyone", I'm not into kids and it weirds me out. Also I have to disagree with your statements about age being just a number.. and idk why you keep telling me you're moving to mexico. Anyway, already blocked you on discord over this ♥♥♥♥, don't make me block you on steam as well.. | 2024-01-19 13:29:32 |
| cam | The Letter 3Groups 5♚𝒯𝓇𝓊𝓂𝓅𝒯𝓇𝒶𝒾𝓃 -𝒪𝒢♚58 Membersℋell ☺n ℰarth7,560 Members๖ۣۜSєχ♫ ♪192 Members | 2024-01-15 19:26:22 |
| The Letter 3 | Lol, u were far too easy... already crying and giving up. ahahhaha! go delete more comments scum bag. and stay the fq off my profile. Sick of you coward idiots. | 2024-01-15 18:49:12 |
| cam | There's no point in talking to you, I can see by how you insult, how you spell and how you construct your sentences that you're nothing but an ignorant, illiterate rightoid. Stay mad. | 2024-01-14 19:56:26 |
| The Letter 3 | lol, the only tough boy wannabe here is you.... ooo ur so scary talking about breaking piece of wood. hahahahah | 2024-01-14 17:34:31 |
| cam | PENSAABA QUE ERAS YUKIKALISTENER XDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDd puto kpoper | 2024-01-13 16:11:16 |
| 34 | SOY MERAMI CAM CSGO | 2024-01-13 16:10:21 |
| cam | They do if I break their spine in half, braindead internet tough boy wannabe | 2024-01-13 14:03:38 |
| The Letter 3 | Twigs don't fold you idiot. | 2024-01-13 12:22:43 |
| cam | Why are you so upset? I could fold you like a twig | 2024-01-13 06:13:56 |
| The Letter 3 | mOMMY TELL U ITS bED tIME? fQN BCH. | 2024-01-13 00:22:45 |
| The Letter 3 | I called you no racism you lying scum bag. where? ur a dirty liberal pos. | 2024-01-08 17:43:00 |
| cam | What part of my attitude gave away I have a personality disorder? Please elaborate. | 2024-01-07 12:53:03 |
| cant pull anything :/ | if your wondering how a person with personality disorder acts this is your guy | 2024-01-06 11:43:23 |
| sibop | CREEP | 2024-01-06 11:35:31 |
| Supersonic Saint | Simple Dimple | 2024-01-03 12:13:33 |
| Maze | sad day | 2024-01-03 09:43:53 |
| cam | Steam said it was breaking their ToS (which wasn't) for some reason, I guess they took the ahegao pfp and thought it'd be the perfect excuse to get it banned. The owner gave it to me after creating it in 2007 and it's honestly one of the worst things that happened to me on Steam. ♥♥♥♥ jannies | 2024-01-03 04:26:35 |
| Maze | why goat group banned | 2024-01-02 22:30:00 |
| The Letter 3 | nothing but loser comments on this page. pathetic pole smokers. | 2024-01-01 17:39:27 |
| Supersonic Saint | Hope ur new years was stellar! | 2024-01-01 16:59:47 |
| 73 50 60 ничецк 2-bit | huh, you're alive, glad. | 2024-01-01 09:58:27 |
| cam | tejmar my love | 2023-12-20 06:27:47 |
| tejmar | Hi Cam!!!! | 2023-12-18 06:33:45 |
| cam | I ♥♥♥♥♥♥♥ deleted his message by mistake AHDFSHAFDFDDSJHFGDJERWEGHGJ,KJHGFD6yg36kñ+<+{ | 2023-12-18 04:34:09 |
| cam | Why are you so mad? We're just roleplaying right? You're the dumb hillbilly and I'm the smart liberal, right? | 2023-12-18 04:33:26 |
| The Letter 3 | Sorry your stupid generation just lives off their parents and are too stupid to realize the truth u fq boy. | 2023-12-15 18:56:57 |
| Ralf BockwurstHEBEL | -rep noob | 2023-12-05 13:29:11 |
| cam | Are you actually braindead or is your senile dementia finally kicking in? | 2023-11-25 04:47:39 |
| Ralf BockwurstHEBEL | How can you say you're good when THIS is how you move? https://streamable.com/88ml0r You should be a bit more humble and admit defeat instead of deleting something dedicated 5 minutes of their life to typing. That's already more than what your parents ever did for you. Noone tried to be toxic, but you took everything like a personal attack with zero humility. You're the definition of a bad person. Come on, delete this too and block me. I've already won. | 2023-11-22 13:24:10 |
| Ralf BockwurstHEBEL | -rep really really really bad player with 0 aim | 2023-11-19 18:11:53 |
| Supersonic Saint | no, u based >~< | 2023-11-19 17:49:46 |
| billE | middleman services? | 2023-11-18 19:30:36 |
| BOT Dennis | -rep 0 kills on wingman | 2023-11-18 18:57:31 |
| ZÖKH | https://steamcommunity.com/sharedfiles/filedetails/?id=3087773295&fileuploadsuccess=1 share this with everyone you know, friends and enemies even | 2023-11-18 17:23:19 |
| x | What happends to the trivia guy on your friendlists? | 2023-11-18 17:10:07 |
| ok bye | Whoops... I shoudn't post here | 2023-11-17 17:23:39 |
| cam | 123 | 2023-11-17 17:16:19 |
| ok bye | I survived the ban wave. But soon wiped | 2023-11-16 16:29:40 |
| Abdallatef | israeli kid noob csgo player | 2023-10-29 19:21:18 |
| cam | :3 | 2023-10-28 15:35:30 |
| Schäbiger Mann | Sorry for killing you in mirage :3 | 2023-10-27 18:09:22 |
| cam | based | 2023-10-25 12:40:36 |
| oloof | https://www.youtube.com/watch?v=kzqJzvfi6H0 | 2023-10-24 20:42:02 |
| [✡︎SCL✡︎]sacamantecas乡 | hola | 2023-10-23 00:01:49 |
| cam | hola | 2023-10-22 15:46:36 |
| [✡︎SCL✡︎]sacamantecas乡 | +rep | 2023-10-22 15:40:19 |
| krosh1001 | +rep | 2023-10-21 12:01:00 |
| cam | https://youtu.be/gOQjVvnNI-4?si=ojTtWCWX495tiaX9 | 2023-10-21 09:33:31 |
| Coal Shoveler | Egg Rorr Dim Sum | 2023-10-04 21:06:22 |
| Rozz Synthclair | arthritis dementia and alzheimer's | 2023-10-03 21:41:18 |
| cam | cope | 2023-09-24 19:31:20 |
| . | Catalonia doesnt exist | 2023-09-23 08:36:29 |
| nori | hi it's me from lastfm | 2023-09-07 05:19:59 |
| erionn10 | sorry camerito my mouse is broken no game for me | 2023-08-25 08:08:31 |
| cam | russian XDD | 2023-08-24 05:11:09 |
| !!!!!! | russian kiddo | 2023-08-23 10:31:11 |
| cam | https://youtu.be/-QFMJ4h6srE | 2023-08-17 03:55:11 |
| Takiton Elkrow | i think i like scraping people with knives in a gentle way | 2023-08-16 22:38:15 |
| cam | no | 2023-08-11 17:10:19 |
| simon | steam is MAPhobic. | 2023-07-26 19:39:40 |
| childsexer82 | b | 2023-07-23 21:37:47 |
| erionn10 | signed by erionn10- SPAIN IS CATALONIA | 2023-07-22 17:40:16 |
| JacK | ++ rep | 2023-07-19 05:59:17 |
| cam | oka | 2023-07-14 18:46:51 |
| oğuz | 1 ıq noob | 2023-07-14 14:58:22 |
| Lambard | Toxic with a dead family | 2023-07-13 06:36:36 |
| cam | What is this turkish dog talking about | 2023-07-11 08:29:44 |
| MES rustchance.com | -rep nice bot 3 kill 9 death and still calling me out bot lol | 2023-07-10 12:34:40 |
| cam | you did exactly 0 things for the team | 2023-07-05 12:12:14 |
| PenQxy | -rep moron bottom fragging but still complaining :DD | 2023-07-05 12:05:43 |
| twitch & kick / JorgeAsault14 | +rep sexy men | 2023-06-30 14:25:02 |
| Markrar | cam csgo | 2023-06-25 16:53:36 |
| cam | I think it's a steam mod... tryin to protect me from the ban... workin from the shadows............ thank yuo anomymous moderator....................................,,.... | 2023-06-21 17:25:08 |
| clay | the cam? nope | 2023-06-18 22:53:40 |
| Nelex | maybe | 2023-06-17 04:59:57 |
| cam | bro am I tripping or did the latest 4 comments (mine included) get deleted for no reason | 2023-06-17 03:01:36 |
| Nelex | penme | 2023-06-16 17:09:04 |
| cam | What the ♥♥♥♥ | 2023-06-16 16:22:56 |
| Мелатониновые сны | nice stickered ^-^ | 2023-06-12 00:24:53 |
| hairy.passage 乡 | brush the stacies off now, our omoriiii boy. all these women never treat me right, and they haven't got a clue. because IIIII AM A REDDITORRR TOO! | 2023-06-10 00:48:50 |
| Nelex | jajajajaj lloron | 2023-06-07 16:32:30 |
| Twitch.tv/macutoghoster | Eres tonto o algo? Echas a la peña por la puta cara? | 2023-06-07 10:28:45 |
| Twitch.tv/macutoghoster | -rep ♥♥♥♥♥♥ kicking by the face | 2023-06-07 10:28:25 |
| Nelex | a bot commented before me | 2023-06-07 09:13:13 |
| Darth Hater | An awful individual | 2023-06-07 05:42:30 |
| Coal Shoveler | Jananana! | 2023-06-07 00:57:58 |
| ❀︎RiVAL | +rep a little bit poor and autistic but atleast he bends over when asked to | 2023-06-06 12:50:58 |
| photostel 乡 | Well, now that it's official that the Fed has the mandate to promote racial equity and justice, I guess they're going to pivot back to QE later this month and start printing money for ♥♥♥♥♥♥♥ and giving Jews -10% loans. | 2023-06-06 12:48:32 |
| cam | ALL my comments have been wiped, once again, because steam "support" misflagged a comment, once again, and had my account locked for a few hours, once again. mfw | 2023-06-05 17:23:00 |
| hairy.passage 乡 | I hate cam | 2023-06-05 14:17:20 |
| X | I love cam | 2023-06-05 04:04:14 |
| hairy.passage 乡 | dont insult my artwork | 2023-06-04 17:26:42 |
| Rupert | hahaha ez | 2023-06-04 16:14:17 |
| ⑲𝕄𝕒𝕣𝕢𝕦𝕖𝕤 | nerd | 2023-06-04 14:39:45 |
| X | hi | 2023-06-04 11:17:49 |
| Nelex | kvs | 2023-06-03 16:21:58 |
| Malalore | signed :) lets play csgo | 2023-06-03 16:08:34 |
| Señor Ross | you asked how much for my sawed off - not for sale | 2023-05-31 10:29:30 |
| clay | thinking about | 2023-05-29 03:41:00 |
| Nelex | tnd | 2023-05-28 07:25:32 |
| Campyfire | uooooh | 2023-05-27 23:29:10 |
| ł₲₲Ɏ | делать ♥♥♥♥♥♥♥♥♥♥ никакой личной жизни сидит задротит ебанай иди работай | 2023-05-27 17:01:48 |
| kRiZayyツ? | YES IM FOLKS | 2023-05-26 08:15:52 |
| pussy wind | ♥♥♥♥♥ wind | 2023-05-24 19:24:34 |
| Nelex | ambatukaaaaaaaHAAAAAAAaaaaaaaamaaaaaaaaaaaAAAAAAAAaaaaaAAAAAAAaaaaaahh!!! | 2023-05-23 19:00:29 |
| amagi4791 | counter strike loli offensive | 2023-05-23 08:53:42 |
| Nelex | ok | 2023-05-22 18:26:15 |
| Supersonic Saint | Scary profile nice, but the Nekopara gameplay stands out haha | 2023-05-22 17:25:47 |
| Rylop | welcome, today, in csgo | 2023-05-21 15:39:35 |
| Nelex | cs g | 2023-05-21 13:03:38 |
| AydanJT7 | CAM... | 2023-05-19 18:44:57 |
| Coal Shoveler | Grapples! | 2023-05-15 02:13:57 |
| Nelex | jajajajajaj | 2023-05-11 06:02:47 |
| luis | ESPANOL PENDEJO | 2023-05-11 00:26:17 |
| Nelex | why so mad | 2023-05-10 08:33:49 |
| ♚Calz™♚ | -rep stupid mong | 2023-05-10 07:36:47 |
| ♚Calz™♚ | -rep black | 2023-05-09 16:49:55 |
| ♚Calz™♚ | -rep check this ♥♥♥♥♥♥ drives | 2023-05-08 18:36:24 |
| 𝐑𝐲𝐚𝐧™ | -rep 5-13 in retakes, toxic and doesnt have a gf! get a life! | 2023-05-08 17:07:13 |
| ♚Calz™♚ | -rep ass n toxic! also searches for cp! | 2023-05-08 16:59:02 |
| kRiZayyツ? | SMD | 2023-04-26 14:27:41 |
| kRiZayyツ? | who u goofy | 2023-04-26 14:27:30 |
| Han$i the Hitt€r | +rep OG Inventory :D | 2023-04-23 19:20:28 |
| Nelex | deserve what? | 2023-04-22 13:56:56 |
| fasariya | you deserve it | 2023-04-22 13:44:36 |
| g4v3r | Hey dude, your friend has a problem with his erection so he decided to call you for help? Your pal (аlthough for some reason I already think that you are the same person)----------------- wished death for people in the game----------------- because of his weakness. Do I need to explain what spectrum of mental illness this behavior falls under?If you want to do another swallow, I can give you another from my lvl10 faceit account.Well, about the mistakes I made in a language other than my own, I'll tell you,I don't give a fuсk what language to use to say you're pathetic pieces of zalypa. Fuсk you with your own guns. Write more suckers if you don't have ass ripped enough. | 2023-04-15 21:28:09 |
| Miller | ++++ | 2023-04-13 13:57:51 |
| Andrej Tatovic | Whats wrong with being racist? | 2023-04-12 04:04:50 |
| Nelex | lol ur comments got nuked | 2023-04-11 19:24:03 |
| SOL0X | HES RACIST KID | 2023-04-08 11:10:45 |
| Nelex | he deleted here too lmao | 2023-04-04 20:22:37 |
| Nelex | https://imgur.com/a/uaair6D *loses game**calls other team bots* | 2023-04-04 12:40:27 |
| λ | catalanes ser como((no existen no tienen pais)) | 2023-04-02 19:41:36 |
| Nelex | vivimos en una sociedad | 2023-03-31 08:01:43 |
| Nelex | cam csgo | 2023-03-30 20:00:55 |
| Nelex | vid3eo cmera | 2023-03-30 08:14:27 |
| シ | +rep, very good teammate | 2023-03-26 11:30:36 |
| Elizabeth | added for trade | 2023-03-25 07:52:56 |
| spanden #FreeNavalny | -rep little child | 2023-03-11 05:10:46 |
| Nelex | -rep little child, Very bad player / Toxic and 0 Skill! | 2023-03-09 11:21:30 |
| Cosmic | -rep little child, Very bad player / Toxic and 0 Skill! | 2023-03-05 18:29:17 |
| Chairman | +rep very good team player | 2023-03-04 18:11:42 |
| Antonio | +REP CASTELLANO | 2023-03-01 17:33:18 |
| Nelex | bau | 2023-03-01 13:47:42 |
| Apollo | sanest ohio resident | 2023-02-20 17:16:17 |
| ☠𝕄𝕣.ℍ𝕀𝕁𝔸☠ | noob virgin on game the reasone why you dont go outside home is bcs no one like boy who talk like girl | 2023-02-20 05:06:41 |
| ☠𝕄𝕣.ℍ𝕀𝕁𝔸☠ | absolute bot | 2023-02-19 06:39:23 |
| boog vs elliot who poops more | Cuz u having fun and he not | 2023-02-16 13:08:00 |
| FIИИ | 3k hours and still trash af | 2023-02-12 11:50:54 |
| FIИИ | Mad cuz trash, maybe u should uninstall cs go and go play some Fortnite ♥♥♥♥♥♥♥ idiot | 2023-02-12 11:50:32 |
| mileinmortal | CSGO cajas abrir exito 100% | 2023-02-12 10:17:49 |
| cl_muted | bot :( | 2023-02-08 23:21:26 |
| mileinmortal | milwinmortal | 2023-02-05 05:46:08 |
| Polar | Polar | 2023-02-03 20:52:02 |
| ANNOYING SMOKER CROW | CAW NORMAN | 2023-02-03 10:00:01 |
| GODRilla (On Wheels) | Operation culo | 2023-02-01 19:43:36 |
| flor's official bf :3 | -Rep ♥♥♥♥♥♥♥ idiot | 2023-01-29 23:21:19 |
| godly | amigo | 2023-01-29 10:18:43 |
| Sternbreaker | signed by me, lets play csgo | 2023-01-28 19:41:32 |
| zuramaru | 🚸⚠️ATAQUE ESPECIAL🚸⚠️💚💜💚💜💚💜💚💜💚💜방탄소년단 방탄소년단섹스 소년단섹스 소년단관통 관통관통관통방탄소년단 방탄소년단관통관통관통관통**관통 소년단방탄소년다 방탄소년단💜💚💜💚💜💚💜💚💜MANDALO A TODAS LAS ARMY'S◣ ◢█ ██ █◤ ◥BTS | 2023-01-23 13:33:06 |
| ๔—︻ჯИƎႧỼஜ | you're awesome! | 2023-01-21 21:27:29 |
| ๔—︻ჯИƎႧỼஜ | wtf why did i block you....... | 2023-01-21 21:27:21 |
| ANNOYING SMOKER CROW | CAW | 2023-01-19 11:09:19 |
| GODRilla (On Wheels) | I took those pills you gave me and now I have big tiddies, thanks. | 2023-01-12 01:03:39 |
| selec | 中國政府保護該用戶 | 2023-01-11 23:48:44 |
| aafmjknn s;jknc | ola | 2023-01-10 17:09:28 |
| ANNOYING SMOKER CROW | cam I ♥♥♥ your mossa | 2023-01-10 07:32:19 |
| N0TSM1L3D | im not vac banned u ♥♥♥♥♥♥ | 2023-01-09 18:36:38 |
| N0TSM1L3D | who tf are u ♥♥♥♥♥ | 2023-01-08 19:34:39 |
| flor's official bf :3 | hola seguime vos @saddestoti | 2023-01-08 17:05:20 |
| ANNOYING SMOKER CROW | cam gaymer | 2023-01-07 09:01:10 |
| 💗Li 丽 | 一起玩吗？上次一起打过 | 2023-01-06 05:35:42 |
| Ange |Vizeo| | Antifa ? AH AH AH Run ♥♥♥♥♥♥♥ | 2023-01-04 14:01:34 |
| ❖ Weforex | I love you bro❤️❤️ | 2023-01-04 13:37:16 |
| FreeNavalny | I kissed this boy and we became a great couple in the counter strike game | 2023-01-04 10:57:18 |
| lance | trash kid.Always last on the scoreboard but keeps on talking.I think he just needs some love from other men | 2023-01-04 08:32:06 |
| GODRilla (On Wheels) | Have you ever made gumbo? | 2023-01-04 00:31:10 |
| GODRilla (On Wheels) | How's your soup? | 2023-01-03 22:17:02 |
| GODRilla (On Wheels) | Your mom is a good cook, i like her foods. | 2023-01-03 10:56:25 |
| двойник Дьявола | i hope italian got your m0m | 2023-01-03 09:24:20 |
| kubota | ♥♥♥♥ noob | 2023-01-02 11:19:23 |
| 123 | +rep | 2023-01-02 06:05:57 |
| kubota | noob | 2023-01-01 18:44:53 |
| ANNOYING SMOKER CROW | man drop me AWAPE men give me your ♥♥♥♥... men | 2023-01-01 11:20:20 |
| lord knows | +rep, absolutamente fantástico | 2022-12-31 17:56:35 |
| elPATRÓN | Pero que ladras payaso | 2022-12-31 07:16:10 |
| Summi | прими го обмен | 2022-12-30 04:37:55 |
| Moogulkree | signed by me, lets play csgo | 2022-12-28 18:13:41 |
| flor's official bf :3 | MERRY CHRIMAS 🎄 | 2022-12-27 08:19:34 |
| ANNOYING SMOKER CROW | Professioinal GAMER. cam. gamer. i am gamer. | 2022-12-27 05:23:27 |
| я люблю Россию | а схуяли я не должен любить страну в которой живу 17 лет? Россия мне ничего хуевого не сделала, а то что ракетки прилетают по свинкам(энгри бердс) меня вообще не ебет, так как они сами пикнули клоуна в президенты | 2022-12-26 16:43:30 |
| ✪-Tr3ner | bot | 2022-12-25 15:27:59 |
| briiibaby | MERRY CHRIMAS 🎄 | 2022-12-25 05:19:58 |
| Джармен Келл | ez | 2022-12-24 22:49:40 |
| GODRilla (On Wheels) | +rep not a sodomite | 2022-12-23 21:16:09 |
| Seomate ✔ | + rep best christian i know | 2022-12-23 10:14:05 |
| flor's official bf :3 | I want one like you, I prefer that there are two, I smoke and smoke until he coughs, I am your romantic, your bandit, I have the technique to eat it whole | 2022-12-20 19:20:44 |
| Mayvollxgod | and whats the connect beetwen life and game if u are such of damn who think he is the most strongest man u not even saw me in RL life then shut the ♥♥♥♥ up and if u want something add me and send me a Messege dont be like a ♥♥♥♥♥ which crapping only in my comments | 2022-12-12 05:53:45 |
| Mayvollxgod | i am not interest of mans i like girls, u can go continue ♥♥♥♥ with the boys idiot | 2022-12-12 05:49:04 |
| Mayvollxgod | - rep 3.5k played skill = 0 | 2022-12-10 18:29:09 |
| Mayvollxgod | if something i have even proofs | 2022-12-10 18:28:22 |
| Mayvollxgod | hahahahhaha Smart slave i told u go to my acc comments and u was listen me to did this son of a bi tch hahahahaha | 2022-12-10 18:27:47 |
| M X T | -rep crying noob | 2022-12-09 16:18:54 |
| ︻芫 —— Clutch Norris | -rep typical drunk russian bronze bottom forever | 2022-12-08 16:25:57 |
| flor's official bf :3 | BAAAAAAKAA | 2022-12-07 20:45:09 |
| Vroom Vroom | NE TIPO ABSOLUTE BOT! VAHYE | 2022-12-04 14:33:14 |
| GODRilla (On Wheels) | My dad made me and my brothers jump out windows and if we messed up he'd have us lay on the ground and scream "help, I got glass in my vagina". | 2022-12-03 21:31:55 |
| Maneyo | -rep worthless | 2022-12-03 14:27:04 |
| ★Mice | silver | 2022-12-03 14:15:20 |
| X™ | marguana🔥 | 2022-12-03 03:04:19 |
| GODRilla (On Wheels) | They want cam to be the bull | 2022-12-02 23:24:28 |
| ϟ malaK | -rep Catalonia is not a country | 2022-12-02 19:05:29 |
| psygodx | -rep pretends to not be spanish | 2022-12-02 19:05:07 |
| GODRilla (On Wheels) | +rep drugged me and installed a camera in my heqd, made me play a game of death. | 2022-11-22 13:23:30 |
| ♡٣♥ | idle game master | 2022-11-13 08:39:08 |
| GODRilla (On Wheels) | Spain does not exist, never has and never will. | 2022-11-10 21:40:33 |
| Seomate ✔ | who said spain? | 2022-11-10 20:52:01 |
| 2001 chevy highlander | hey, is there any possibility you would trade your sg553 candy apple with the 4 LGB Kato 2015 stickers. I have some stuff to trade in my inventory if youd be interested. I dont really do cash trades to prevent scammers, but if theres some items you want id be willing to buy them on buff, because i love this skin so much and dont wanna waste 200€ to buy the stickers.kind regards | 2022-11-10 00:27:16 |
| Furaik | COBARDE CATALAN | 2022-11-09 09:46:46 |
| Z EmelaVAC FAIL | Соси дура, мать твою в очко ебенил. Слава РОССИИ! | 2022-11-03 05:43:22 |
| Frisout | hey, sorry I saw your profile and I just thought you looked cute in your picture, I really wanted to tell you that)) It's really rare to see girls playing video games haha! I don't know why its a guy thing honestly im like really against misogyny and like ill be the one in the kitchen making sandwiches. We should really play l4d2 sometime its a really cool zombie game with a lot of scary moments, but don't worry ill be there to protect you ;) sorry that wasnt flirting I swear Im just trying to be friendly I really like your profile picture sorry was that too far? Really sorry i'm really shy I don't go out much haha add me on skype we should talk more you look really nice and fun xxx | 2022-11-03 05:28:49 |
| boog vs elliot who poops more | Camera | 2022-10-24 05:28:22 |
| bottom_text | catalonia (spain) | 2022-10-24 05:16:10 |
| GODRilla (On Wheels) | Fecal sammich with sweet urine drippings | 2022-10-20 15:49:01 |
| photostel 乡 | catalonia (spain) aka me | 2022-10-19 15:04:30 |
| bottom_text | buen ingles manito, copero profesional. | 2022-10-17 10:07:08 |
| The Man | true | 2022-10-15 14:57:48 |
| The Man | +rep very sexy | 2022-10-15 14:55:24 |
| The Man | -rep he timed me out for 1 minute | 2022-10-15 14:53:49 |
| Keeksencookie | +rep - very good player & team mate!! | 2022-10-10 01:36:49 |
| Seomate ✔ | >CataloniaOh yeah Spain, I love that place! | 2022-10-05 22:20:11 |
| Seomate ✔ | CAW | 2022-10-05 22:19:47 |
| Give_head223 | ♥♥♥ (kindergarden mode) | 2022-10-01 07:28:52 |
| X™ | Fresh off the boat, from reddit, kid? heh I remember when I was just like you. Braindead. Lemme give you a tip so you can make it in this cyber sanctuary: never make comments like that. You got no reputation here, you got no name, you got ♥♥♥♥♥♥♥♥ here. It's survival of the fittest and you ain't gonna survive long on 4chan by saying stupid ♥♥♥♥ that your little hugbox ♥♥♥♥♥♥♥♥♥♥♥ reddit friends would upboat. None of that here. You don't upboat. You don't downboat. This ain't reddit, kid. This is 4chan. We have REAL intellectual discussion, something I don't think you're all that familiar with. You don't like it, you can hit the bricks on over to imgur, you daily show watching ♥♥♥♥♥♥♥♥♥♥♥♥♥♥. | 2022-09-28 08:57:28 |
| clay | majoring in sexy studies | 2022-09-22 19:13:33 |
| ☆kov | el cam | 2022-09-17 22:29:08 |
| ♛ کżρξÇŋλŻ ♛ | +rep fun guy | 2022-09-09 13:00:19 |
| DropTheBass YT | ok | 2022-09-09 11:25:18 |
| krakenusa3000 | Hola, aquest del rumano box és molt pesat, el coneixes, se fica en tot quan no té diners per comprar skins | 2022-09-08 10:54:48 |
| krakenusa3000 | Agregame te vuit canviar coses del inventsri | 2022-09-07 17:07:05 |
| 花知夏 | I'm sorry if I offended the fact that your father is gay you should have let your father talk instead of your son arguing that you're adopted | 2022-09-07 06:25:33 |
| SS | hii i am interessted in your sg add me if you are looking to trade it ^^ | 2022-09-07 02:50:59 |
| Sherkhan | mega - rep you will get banned for a month, for a flash on your own and for the fact that you are specially for molotov!!!!! you're a toxic ♥♥♥♥, delete the game and play minecraft stupid scarecrow, you and your friend will go to an emergency, you have 1 iq, you're a stupid child, it will turn into a boomerang effect for you, evil always returns to such bastards as you, wait for karma ♥♥♥♥♥, toxic | 2022-09-07 01:20:46 |
| Rumano de VOX | -rep toxic catalan | 2022-09-06 10:53:17 |
| Sherkhan | -rep stupid bot МУДИЛА ♥♥♥♥♥♥♥♥ ТУПОЕ СОЗДАНИЕ МУСОР STUPID GRIEFING!!!! | 2022-09-06 09:40:45 |
| top g | Ok Camilo de la provincial autonoma de españistan | 2022-09-05 23:43:04 |
| top g | Average spanish beta | 2022-09-05 16:34:51 |
| Ivan Tušek | hi man, I am very sorry for leaving the game but i needed to go cuz i my came back home from a trip and they needed help ;) | 2022-09-05 13:40:33 |
| Daniellb | +rep This guy is a real pro and a huge fan of mine. Asked me to sign his profile. So here I am! Good luck in your future games, hopefully playing with you soon!Signed by Daniellb | 2022-09-05 11:35:57 |
| M4nning | Russian dog | 2022-09-04 15:19:01 |
| TUNASUB | +rep | 2022-09-03 14:02:21 |
| Taronjo | taronjo me das una mala espina que flipas | 2022-08-31 03:37:45 |
| Z EmelaVAC FAIL | soo stupid idiot.. | 2022-08-30 17:17:52 |
| bary | why u fanboy keep commenting and stalking my prof and my 2nd acc too? | 2022-08-30 11:11:41 |
| Mechv | my vac is in a different game | 2022-08-29 22:25:44 |
| Dedule Pyzdule | g | 2022-08-27 07:36:50 |
| bary | whoru | 2022-08-26 06:42:05 |
| Dedule Pyzdule | OMG ARE YOU CAMERA FROM BLENDER???? I AM BIG FAN BRATAN!!!!! | 2022-08-22 01:54:37 |
| profile | thats a hot hot rod | 2022-08-21 14:32:59 |
| Nelex | cac | 2022-08-20 17:28:53 |
| Հայ մարտիկ | why don't you go fuсk yourself | 2022-08-20 14:52:46 |
| Joker | Welcome to the excess deaths statistic. | 2022-08-20 11:54:29 |
| Furaik | cam dont say me that ): | 2022-08-17 03:02:59 |
| BaileyP | add looking into the usps serum | 2022-08-14 00:30:49 |
| Elo_Sabotage | give skins , i'm poor ! +repppp Good player btw . | 2022-08-08 14:54:40 |
| ✪ KronoTz | Vale tio | 2022-08-08 08:00:52 |
| K20-TURBINADA!! | Add for trade | 2022-08-07 19:24:28 |
| CiibeR | cam si yo se k me amas :( | 2022-08-05 18:34:30 |
| CiibeR | jajjajaja <3 | 2022-08-05 14:52:37 |
| CiibeR | Eres más malo k un palo en la espalda | 2022-08-05 09:22:04 |
| el demoño | bad karma b low | 2022-08-05 03:57:44 |
| Mozzafiato | I genuinely hope you die in the worst possible way as soon as possible.You're useless, sincerely. | 2022-08-04 12:05:28 |
| doll | aight lemme grab some popcorn and entretain for a bit | 2022-08-04 09:24:59 |
| doll | he malding | 2022-08-04 09:20:18 |
| Geralt of Rivia | Pues bien que copias mensajes mios de otro retrasado, tanto que no te importo crack | 2022-08-04 09:19:55 |
| Geralt of Rivia | Le va a dar al enlace quien yo me sé, si | 2022-08-04 09:07:40 |
| Geralt of Rivia | Tiene que llegar tu amigo Doll con sus bots para que ganes porque contra mi no puedes? Lmao, muy patético | 2022-08-04 06:52:29 |
| Geralt of Rivia | Si no te dije na en toda la partida xD | 2022-08-04 06:45:39 |
| Geralt of Rivia | A llorar que? | 2022-08-04 06:44:28 |
| CiibeR | very easy bot | 2022-08-04 05:26:19 |
| CiibeR | Easy bot | 2022-08-04 05:22:52 |
| chikykilo | kys | 2022-07-31 22:49:15 |
| 𝐹𝒾𝓋𝑒 ★ | try tetris maybe u are better at that... ez game | 2022-07-31 21:04:15 |
| 𝐹𝒾𝓋𝑒 ★ | sell all skins noob... | 2022-07-31 13:40:36 |
| Seomate ✔ | Catalonia? Oh Spain, yeah! | 2022-07-30 15:28:21 |
| el demoño | 123 | 2022-07-28 03:11:16 |
| top g | The only autonomous region I respect is the basque | 2022-07-27 19:26:53 |
| Nelex | Señor Vac 😲😲😲😲 so cool name..... | 2022-07-25 07:17:45 |
| el demoño | INDIA'S PROUD'S | 2022-07-23 16:45:08 |
| We3D | got for no reason in r6 but ok i dont even play this game so ♥♥♥♥ u and bye. | 2022-07-23 04:02:46 |
| We3D | So sad:((( | 2022-07-23 03:57:59 |
| We3D | Vac? i dont see any vac my stupid friend :) | 2022-07-22 11:05:35 |
| We3D | nobody give a ♥♥♥♥ | 2022-07-22 11:03:29 |
| We3D | Why u write this ♥♥♥♥ at my comments? ;)) | 2022-07-22 11:03:12 |
| ☠🅻🅸🅻🅳🅰🆅🅸 | +Rep Buen chaval pero no me liaria | 2022-07-10 20:28:18 |
| NonEmployed | Juicer stickers and inv dude. much love. | 2022-07-10 14:30:11 |
| TheShaark | +rep thanks for compliment on my profile :) | 2022-07-10 13:12:35 |
| Hefe | -rep for being zjeb and daln | 2022-07-10 12:15:43 |
| scorpioN | I ♥♥♥♥♥♥ his mother and she was way too large for my bbc, she can take 10 ♥♥♥♥♥, if any1 is interested, hmu with offers, she is my slat now and she can do anything for like 50 bucks if u came from me and cam to her | 2022-07-08 16:40:31 |
| top g | What's your opinion on interracial marriages | 2022-07-07 01:09:47 |
| daNi | hot as ♥♥♥♥ guy playing cs go, his ♥♥♥♥ so big that he can plant on A while being on B | 2022-07-04 09:53:00 |
| Nelex | i love how everyone comes on this profile to cry and cry only | 2022-07-03 06:47:30 |
| Cousin Artyom | hello guys, I am a cringy anarchist | 2022-07-01 13:16:12 |
| wool | leave my man alone | 2022-06-29 20:49:00 |
| gracie | broke as hell | 2022-06-29 04:05:41 |
| gracie | you busted as fuck loc | 2022-06-29 01:15:37 |
| top g | Oh not even that | 2022-06-27 10:59:37 |
| top g | Your living off the government because unemployment is 50% in spain | 2022-06-27 10:59:28 |
| scatle 4SV | idk, sorry( | 2022-06-27 09:22:02 |
| scatle 4SV | unemployed b1tch | 2022-06-26 18:21:20 |
| Cousin Artyom | if he's french, that means he got a white flag laying somewhere in his house, he might have to use it if u hit him one more time | 2022-06-25 13:06:06 |
| Joker | Vaxxie, Vaxxie, heart attacksieTakes his tests and wears his maskiesStill got Covid, every strainGot spike proteins in his brainGot the VAIDS at 24,"Dr. Fauchi, gimmie more!"Had a stroke at 25,"Thank Moderna I'm alive!"Swollen heart at 26,Prayed to Pfizer for a fixDied of SADS at 27,Somehow thought he'd get to heavenVaxxie, Vaxxie, heart attacksieTook his clot shots, wore his maskiesObituary headline noted:"Anti-Vaxxer Dies of Covid" | 2022-06-24 05:17:17 |
| Cousin Artyom | you still in the Spanish civilwar? | 2022-06-23 22:45:35 |
| top g | CataloniaAutonomous community of Spain | 2022-06-23 16:37:12 |
| top g | Catalunya Independence soon? 😂😂😂 | 2022-06-23 16:35:42 |
| Seomate ✔ | rozz jimbob the | 2022-06-23 07:10:16 |
| Socks | your watermelon butt cheeks make me hard as a rock bebe gorl | 2022-06-22 07:24:34 |
| ! ! NomadCS Very Low Level Up | are you the gatekeeper of booths comments? | 2022-06-21 14:13:40 |
| Piguman - 永远的神 | pooron | 2022-06-21 13:49:14 |
| the new drip , hello sir, hi | i've enough fascists in my friend list? | 2022-06-21 11:07:15 |
| top g | Catalunya nunca Sera independiente | 2022-06-15 19:43:15 |
| cam | death | 2022-06-14 19:40:13 |
| cam | woah! | 2022-06-14 19:40:10 |
| ☆kov | https://twitter.com/waIlhack/status/1536210051618193408 | 2022-06-13 16:23:43 |
| tarmatanque | que hdp que sos | 2022-06-13 11:06:09 |
| ☆kov | +rep | 2022-06-13 11:01:45 |
| JustBetter | Independizate ya Puigdemont | 2022-06-13 10:37:23 |
| ☆kov | van a morir Cabrones | 2022-06-13 02:17:01 |
| JustBetter | Puto catalán | 2022-06-13 02:09:03 |
| Red-harsok | Sois como dos putos minusvalidos pelandose, un catalan de mierda y un gilipollas con la foto de un negro | 2022-06-12 06:56:21 |
| JustBetter | pasta al tonno con pesto | 2022-06-12 06:15:05 |
| JustBetter | pasta pasta pizza | 2022-06-12 06:14:51 |
| JustBetter | go to eat pasta pls Mario Bros | 2022-06-11 03:58:21 |
| JustBetter | Noooo u called your 13 years old friends haha | 2022-06-11 03:58:08 |
| Nelex | owned | 2022-06-10 12:43:53 |
| Nelex | @Mad?¿ : lol kid you are bot cant play without cheats and u even get vac ban XDD dont talk pls little bot | 2022-06-09 14:54:02 |
| Nelex | :v | 2022-06-09 14:52:49 |
| JustBetter | I said alright lol | 2022-06-09 06:19:30 |
| JustBetter | Let them doing what they want their life is so sad | 2022-06-09 00:05:41 |
| -ˏˋ Kazahanao ˎˊ- 💗 | How you escape mental hospital? | 2022-06-08 16:41:08 |
| JustBetter | Nice english no money 4 english lessons 😂 | 2022-06-08 03:47:35 |
| Apollo | retarded rat | 2022-06-07 10:02:32 |
| JustBetter | -rep noob | 2022-06-07 09:58:21 |
| kosher | you have no friends | 2022-06-04 08:46:24 |
| Apollo | who are you? | 2022-06-04 05:18:49 |
| ..::☣ⓈⓀⒶⓊⓉ☣::.. | -rep bot | 2022-06-03 09:30:14 |
| текила24 | BOT | 2022-06-02 10:20:14 |
| ROGUELIKE | bot | 2022-06-01 15:46:58 |
| Wojtusiek | Easily tilted boy | 2022-06-01 15:09:52 |
| Wojtusiek | stfu | 2022-06-01 15:08:59 |
| Wojtusiek | ta? to zajebiscie | 2022-06-01 14:02:08 |
| Nelex | go uninstall game bot ong -rep bot boosted | 2022-06-01 06:40:05 |
| JM$ | + rep | 2022-05-31 11:48:48 |
| Queen | Nah you are just a immature 12 year old | 2022-05-30 12:21:07 |
| Queen | I reported you because you told me to kill myself are you that thick in the head that you dont know when to stop you really are that incompetent | 2022-05-30 05:26:42 |
| ✪ swag | -bot | 2022-05-28 09:15:13 |
| Queen | lmao this ♥♥♥ told me to kill myself lolololololololololol | 2022-05-28 09:01:18 |
| Queen | He calls people a tryhard when he has 3300 hours 😂😂😂😂 thats funny | 2022-05-28 01:03:44 |
| NSK | tryhard based on what lol | 2022-05-27 20:09:32 |
| w | -rep racist, toxic, bad | 2022-05-27 14:22:48 |
| Queen | dont even know who this pedo is just commented on my profile thinking hes tough ♥♥♥♥ | 2022-05-26 10:17:49 |
| КАМЕНЬ ПРИРОДНЫЙ | Associate Professor of Astrological Sciences | 2022-05-25 17:28:19 |
| КАМЕНЬ ПРИРОДНЫЙ | This man is a great sucker +rep | 2022-05-25 17:16:16 |
| КАМЕНЬ ПРИРОДНЫЙ | Russians suck my ♥♥♥♥ | 2022-05-25 17:14:00 |
| КАМЕНЬ ПРИРОДНЫЙ | Пшел ♥♥♥♥♥♥♥♥♥♥ лох попущеный | 2022-05-25 13:31:44 |
| Davud al Patchir Memorial Page | >dosent understand some dumb acronym>proceeds to call me a nazitruly your iq is showing | 2022-05-25 10:39:16 |
| Davud al Patchir Memorial Page | Cam the 23 year old sodomite on his way to BTFO me epically by calling me a basement dweller | 2022-05-24 13:40:25 |
| Davud al Patchir Memorial Page | >calling everyone a degenerateWhite race=Saved | 2022-05-24 09:36:05 |
| Corneleous the Destroyer | why tell kill myself? That's mean maynn ;--------------------; | 2022-05-24 07:59:07 |
| KaNN † | fake ass ♥♥♥♥♥♥ camera | 2022-05-21 16:50:22 |
| LILJUKU | See on sõpruse munn...........„--~'¯…….'\Lisa see oma sõpradele...... („-~~--„¸_….,/ì'ÌProfiilile.Mida rohkem......„-^"¯ : : : : :¸-¯"¯/'Munne,seda parem. ¸„„-^"¯ : : : : : : : '¸„„,-"**¯¯¯'^^~-„„„----~^'"¯ : : : : : : : : : :¸-".:.:.:.:.„-^" : : : : : : : : : : : : : : : : :„-":.:.:.:.:.:.:.:.:.:.: : : : : : : : : : ¸„-^¯.::.:.:.:.:.:.:.:. : : : : : : : ¸„„-^¯:.' : : '\ : : : : : : : ;¸„„-~"¯:.:.:: :"-„""**/'ì¸'¯:.': : : : :"-„ : : :"\.:.:.: : : : :" : : : : ,:.: : : : : : : : : : : : 'Ì: : : : : : :, : : : : : :/"-„::::„-*__„„~ | 2022-05-20 15:50:35 |
| Juriac | Signed By Device | 2022-05-15 19:32:23 |
| 15cm yarrak | are you posting random text on random profiles? i dont remember u haha | 2022-05-15 08:43:13 |
| Sergio5Star_✪PT♛ | -rep incredibly retarded bot | 2022-05-14 17:18:21 |
| Mrcreeper :) | CHUPAME EL ESCROTOOOOOOOOOOOOOOOO-rep, se la intentó chupar a mi perro | 2022-05-10 10:40:11 |
| Sebastian (cz) | no problem man :) | 2022-05-09 01:24:52 |
| and1xu | nah sorry | 2022-05-08 17:33:34 |
| M00sT | .rep cheater | 2022-05-07 17:06:11 |
| WingsTopRanch | me gushta | 2022-05-01 13:15:14 |
| X™ | 808 mafiosos!"V!"V | 2022-04-30 15:41:53 |
| Nelex | sex | 2022-04-25 15:45:07 |
| Том Chevrolet Груз 200 | gonna die stupid dog | 2022-04-24 12:12:16 |
| 44444444444444444444 | ukrainian superior forces ahahahahahh nice joke u son of wh0r3 :) | 2022-04-24 12:10:21 |
| boog vs elliot who poops more | You will having 1488 quements soon | 2022-04-20 23:17:31 |
| clay | Met this guy at an arby's restaurant, it was cram packed so when I finished getting my order I couldn't find a place to sit and I saw him sitting by himself so I asked, "Hey can I sit here?". He said "Yea go ahead". We started off talking about how crowded it was and we decided to take a walk and talk about what we did as a hobby. We both said we had a PC and had steam so we added each other later when we got home. We played a couple games and decided to meetup the next day at an arcade and went bowling together. We secretly started dating and at the time I didn't know he had a girlfriend and we later went to a cheap motel and as we started sweet talking each other we slowly made out and he put his "spit" into my mouth, a second later I blacked out and when I awoke I was bare naked with semen in my ass and tied up. I untied myself and looked around, my clothes were neatly packed and my wallet was empty with only enough for a uber ride home. | 2022-04-20 21:14:22 |
| NEVERSUCKMYCOCK | КАДЫРОВЦЫ НА УКРАИНЕ = ОТСТРЕЛ ♥♥♥♥♥♥♥♥♥♥ = ЗАБИВ ♥♥♥♥♥♥♥♥♥♥ = ЗАБОЙ СВИНЕЙ = ОТСТРЕЛ СВИНЕЙ = ЗАБОЙ ♥♥♥♥♥♥♥♥♥♥ = ЗАБИВ СВИНЕЙ = ТЕСАК ♥♥♥♥♥♥♥♥ИТ ♥♥♥♥♥♥♥♥ БИТОЙ = БАНДЕРА ЖИВ | 2022-04-20 15:13:20 |
| NEVERSUCKMYCOCK | СЫН ХУЕТЫ ♥♥♥♥♥♥♥♥♥♥♥♥ | 2022-04-20 15:11:48 |
| NEVERSUCKMYCOCK | Oh ya, Opa bite ficke mine arsch | 2022-04-20 15:11:33 |
| Silver Bunny | lel | 2022-04-19 17:20:32 |
| /del | ПОШЕЛ ♥♥♥♥♥♥♥♥♥♥ СЫН БЛЯДОТЫ | 2022-04-19 14:21:04 |
| Grodan🐸🐸🐸 | Saw you on "best pos for every kato 2014 sticker". In January you commented "can you rate my sg" so checked out your inventory and I don't regret it. Nice inventory dude! | 2022-04-19 06:11:10 |
| Grodan🐸🐸🐸 | Yeah you overpaid quite a lot lol, that glock maybe worth 50 or so if you go for the standard 10% sticker price after they are applied. Altho you are right, it is very unique and looks very good. Would get one of my own if I wasn't a gambling addict and would deposit that for a couple of bucks on a gambling website. | 2022-04-18 19:21:17 |
| Grodan🐸🐸🐸 | +rep Profile picture is of a blender camera | 2022-04-18 17:23:18 |
| Grodan🐸🐸🐸 | Hey! Saw you on a community guide and I was just wondering how much did you pay for your glock? I'm not interested in buying it or anything, I'm just curious because I really like it. | 2022-04-18 17:21:45 |
| Margot Robbie Enjoyer | Cheers bro, yours too x | 2022-04-18 07:58:05 |
| clay | hello cam. i am not a bot. important question: can you do a hand stand? thank you. (I know this comment sounds like if I were a bot or a scammer but I'm not, check out my profile/inventory and please, tell me something!) | 2022-04-14 00:57:29 |
| altair | can't here you from up here on my throne of hunnid bands$$$ | 2022-04-13 14:35:55 |
| Happy | Hey, is your glock with the x4 ibuypower dreamhack for trade? I’m collecting 2014 sticker crafts. Send me a trade offer yourself with your price, I have many skins for you to choose ( tradelink on my bio ) or add me if you want, so we can discuss, thanks! I see you don't play CS:GO anymore so the skins I send you, can be sold on the community market so you can buy games or whatever. (I know this comment sounds like if I were a bot or a scammer but I'm not, check out my profile/inventory and please, tell me something!) | 2022-04-13 07:25:23 |
| Hugger3000 | No som espanyols, som castellans | 2022-04-10 17:32:46 |
| Hugger3000 | -rep català | 2022-04-10 09:13:40 |
| Antonio | -rep catalá | 2022-04-10 08:33:26 |
| ReNa | -rep spanish | 2022-04-09 19:17:59 |
| mog. | no hands | 2022-04-09 18:59:46 |
| Der_Adler | herasment | 2022-04-09 18:47:23 |
| Antonio | me cago en cataluña, viva castilla | 2022-04-09 18:40:43 |
| SuperSchnibbler | funny profile ngl | 2022-04-09 18:21:32 |
| JustBetter | fuera de españa catalán | 2022-04-09 17:27:03 |
| spanden #FreeNavalny | got nothing to say poor kid | 2022-04-08 13:13:46 |
| spanden #FreeNavalny | KEKW | 2022-04-08 13:13:33 |
| spanden #FreeNavalny | u have no life since u are a kato collector | 2022-04-08 12:26:54 |
| spanden #FreeNavalny | i have family and friends unlike u | 2022-04-08 12:25:59 |
| spanden #FreeNavalny | KEKW | 2022-04-08 12:25:35 |
| spanden #FreeNavalny | DID I JUST SAY KEKW? OH MY | 2022-04-08 10:55:43 |
| spanden #FreeNavalny | i cri everytim | 2022-04-08 09:45:33 |
| spanden #FreeNavalny | KEKW | 2022-04-08 09:45:18 |
| spanden #FreeNavalny | cry about minorities being offended | 2022-04-08 06:26:52 |
| spanden #FreeNavalny | yes cuz u gotta take out the trash from your room sometimes btw check ur trash bin and go outside touch grass | 2022-04-08 06:25:16 |
| m4dtr4sh | +rep he is from spain not catalonia | 2022-04-08 04:45:12 |
| spanden #FreeNavalny | minorities mad | 2022-04-06 09:11:12 |
| snow. | naughty boi | 2022-04-05 08:43:16 |
| noak CaseOpening.com DROP.SKIN | just a toxic kid sad with life | 2022-04-04 17:05:31 |
| snow. | man, accept friend request.. I have questions | 2022-04-04 11:14:44 |
| snow. | o.O | 2022-04-03 13:49:10 |
| snow. | especially the sg553 | ♥♥♥♥♥♥ gaming | 2022-04-03 13:35:37 |
| snow. | nice inv, really interesting... o.o | 2022-04-03 11:52:15 |
| boog vs elliot who poops more | Rozz is me | 2022-04-02 00:53:44 |
| MAXIM | 1kill dog) | 2022-04-01 13:37:58 |
| Bealanim | Sup! lets play CSGO | 2022-03-31 00:34:28 |
| 1unodos | Apestaoo sucio insecto | 2022-03-26 14:11:03 |
| boog vs elliot who poops more | Hello I hope you are having a fantastic day today. I also hope that you collected a lot of information with your cameras too | 2022-03-24 17:45:46 |
| chupapi muñaño mu ñaño bola | venga va q ya te encontraras otra vez con el suerte tio!!!!1 | 2022-03-24 17:19:25 |
| chupapi muñaño mu ñaño bola | insultando a la gente diciendo que se suicide y no se que pollas jajajaj, estas super ofendido desde que no jugaste contra staxx y te perdiste esa partida, no tengas rencor va, tampoco envidia, seamos amigos niño rata | 2022-03-24 17:18:12 |
| chupapi muñaño mu ñaño bola | te detectamos q eras tonto desde el minuto 0, por algo te fuiste kickeado | 2022-03-24 17:17:22 |
| chupapi muñaño mu ñaño bola | lo que tu digas, pero te perdiste la partida contra staxx jajajajajajajaj | 2022-03-24 17:16:26 |
| ~r~ Never ~u~ Forget ~r~ Loyalty | Firmado por m0re, despues d haberte destrozado ajaj | 2022-03-24 16:32:56 |
| chupapi muñaño mu ñaño bola | venga va si quieres te carrileo un pokito y le hacemos stream snipe al frank otra vez | 2022-03-24 16:21:10 |
| chupapi muñaño mu ñaño bola | estas to picao XD pierdes la oportunidad de tu vida en el csgo de la forma mas patetica posible, venga saludos jjiijijijijijiijiji | 2022-03-24 16:19:48 |
| chupapi muñaño mu ñaño bola | de aqui 5 años igual te lo encuentras, buena suerte mancazo | 2022-03-24 16:19:14 |
| chupapi muñaño mu ñaño bola | venga tonto, te jode que te hayamos kickeado contra el staxx eh? que pena jijiji | 2022-03-24 16:18:56 |
| Гетьман✙lanos✙ | пішов ♥♥♥♥♥♥♥♥♥♥ лярва | 2022-03-24 15:15:00 |
| chupapi muñaño mu ñaño bola | no has tenido el placer de jugar con el, por tonto saludos | 2022-03-24 11:06:22 |
| chupapi muñaño mu ñaño bola | estas to mad pringao | 2022-03-24 11:06:07 |
| kerry caverga | ª | 2022-03-21 19:58:02 |
| poohole42 | 3k hours and comments ♥♥♥♥ to other profiles... Certified pro! | 2022-03-21 08:21:12 |
| kerry caverga | hola lindo, no te llegué a reportar xd solo el comentario, ya lo borré. Picos <3 | 2022-03-20 15:09:36 |
| oliot | sell skins xd | 2022-03-19 18:41:31 |
| Antonio | Viva España y viva Castilla | 2022-03-19 18:38:43 |
| Fluppenkirsch | why so toxic? | 2022-03-19 14:28:10 |
| 76561197960946401 | grande cam, sentimos profundamente lo del kickeo, que tengas un buen dia. | 2022-03-18 21:13:48 |
| Alex_Col | Top 3 mejores personasnumero 1 : Cam | 2022-03-18 18:42:59 |
| 1994 Honda Civic | Grande cam , un capo <3 | 2022-03-18 18:39:15 |
| edgy ano | <3 | 2022-03-18 18:38:45 |
| MysT1c | GRANDE CAAAAM | 2022-03-18 18:34:04 |
| Natsu | te quiero cam <3 no tiene cheats este tipo | 2022-03-18 18:28:40 |
| Patrikcio_ | El no es chitero gente <3 | 2022-03-18 18:26:12 |
| MysT1c | Que no es cheateeer | 2022-03-18 18:24:32 |
| Matox | tu eres piola pa | 2022-03-18 18:24:03 |
| Weather // ⛩ | el no es el cheater gente. | 2022-03-18 18:22:54 |
| D☯NEX™ ツ 火の決意 ❤ | -rep nice wh stuf kid | 2022-03-18 18:18:37 |
| 𝔸𝕝𝕗𝕒 ® | bot ♥♥♥♥♥♥ kid | 2022-03-17 13:13:26 |
| 𝔸𝕝𝕗𝕒 ® | -rep toxic | 2022-03-17 10:54:29 |
| SONKYO | Fuсk, at least I was worthy of this, you have zero constructive dialogue, as well as brains, get down from the tree, you fuсking macaque | 2022-03-17 09:20:21 |
| 💔💔 | Bot closes the tables | 2022-03-16 08:05:06 |
| SONKYO | God, you piece of bastard, I hope for your pizdabolism, you've been fuсked and humiliated all your life, fuсking illiterate offended | 2022-03-15 16:42:45 |
| SONKYO | ♥♥♥♥♥♥♥♥, I'll be smarter than you, son of a leaky wh0re, once I improvised, you just sit there, on the bottom of your knowledge | 2022-03-15 16:40:56 |
| SONKYO | Just know, you piece of a fuсker, you don't need to fuсk in the chat, and trayhard in the warm-up, if you go to the rink like carrion, in last place | 2022-03-15 15:12:08 |
| SONKYO | in your language, the letter p, isn't it pronounced like pi, if you take the transcription, you fuсking scarecrow? | 2022-03-15 15:11:04 |
| Dave Hardstylerz | dont u like it? =( | 2022-03-15 07:27:47 |
| SONKYO | Cry more baby and suck my 3.14ennis | 2022-03-15 06:45:14 |
| Гена | -rep very ez bot | 2022-03-15 06:44:50 |
| boog vs elliot who poops more | Aim for the eyes | 2022-03-14 19:42:17 |
| Hef3 | Aim for the chest, I prefer it when it doesn't hit me in the mouth. ♥♥♥ leaves a sour taste | 2022-03-14 18:39:02 |
| xxxlol | es un puto crio da pena tanto jugar con el y hablar tiene 7años de mentalidad y 2 de aim pargueloon | 2022-03-14 11:39:35 |
| xxxlol | mejora tu aim pinpin | 2022-03-14 08:58:40 |
| xxxlol | pajerooooooooo | 2022-03-14 08:58:29 |
| xxxlol | gordoooooooooo | 2022-03-14 08:58:25 |
| xxxlol | dile a tu madre que es muy pu,aaaaaaaaaaaaaaaaaa | 2022-03-14 08:58:14 |
| xxxlol | dile a la asquerosa de tu madre q tiene un hijo q da penaa la gorda de tu madre | 2022-03-14 06:50:05 |
| xxxlol | animos va inutil q te lo explico la ultima vez pedazo mierda | 2022-03-14 06:48:14 |
| xxxlol | inutil | 2022-03-14 06:46:09 |
| xxxlol | a llorar a la lloreria pollo | 2022-03-14 06:45:44 |
| xxxlol | illo puto inutil si eres manco no es mi problema mejora primero y luego me comentas puto manco | 2022-03-14 06:45:29 |
| DaThompi | stinkyyyyyyyy | 2022-03-13 17:30:05 |
| -Wut ॐ | I am the bot? look at u dumb ♥♥♥♥♥♥ | 2022-03-12 14:31:45 |
| xxxlol | ♿ a si te he dejado manco | 2022-03-12 11:15:45 |
| boog vs elliot who poops more | Cam :cam: :camera: :spyware: :spying: :detective: | 2022-03-10 17:44:18 |
| boog vs elliot who poops more | Muscleman8562 | 2022-03-09 07:45:19 |
| boog vs elliot who poops more | Muscleman8562 | 2022-03-09 06:57:48 |
| Carol ly | Added you to play:D | 2022-03-07 22:41:37 |
| Nelex | mald cope | 2022-03-06 12:47:47 |
| Dany | -rep bot | 2022-03-04 20:59:51 |
| m4dtr4sh | +REP DUMB CATALONIAN | 2022-03-04 17:35:11 |
| Leutzu#10 | trash | 2022-03-03 06:16:38 |
| boog vs elliot who poops more | OMG CAMMY WAMMY | 2022-03-03 04:04:27 |
| YT pechinaCSGO =) | gg | 2022-03-02 17:55:55 |
| b4lde | dingle | 2022-03-01 10:21:56 |
| Andrew (Romania) | wanna play ? | 2022-02-28 07:29:03 |
| Andrew (Romania) | stfu , my teammate was a piece of ♥♥♥♥ | 2022-02-28 07:28:26 |
| Csórógyerek | Nice red theme inventory | 2022-02-26 13:28:57 |
| X™ | da cat drank da lean | 2022-02-23 11:00:03 |
| 16:9 | 1920X1080 | beksa | 2022-02-22 05:30:28 |
| boog vs elliot who poops more | Don’t listen 2 b low… | 2022-02-22 05:07:22 |
| Thug Hunter #ThugShaker | Why are you gay? ♥♥♥♥♥♥♥? | 2022-02-21 13:22:19 |
| boog vs elliot who poops more | OMG HAPPY BIRTHDAY!!! SO PROUD OF YOU... OMG! I JUST REALIZED, YOU DONT HAVE TO LIE ABOUT BEING 13 OR OVER ANYMORE YAYYYYYYYYY | 2022-02-20 20:10:26 |
| zimboz | very cringe played terraria | 2022-02-20 16:36:36 |
| Chop Huey | Happy B-day | 2022-02-20 14:58:24 |
| Nelex | my beloved | 2022-02-20 10:48:01 |
| Nelex | happy day of birth | 2022-02-20 10:47:49 |
| boog vs elliot who poops more | CAM WANT DAT CUTIE ISRAELI PUS PUS DAT IS NEGEVS PUS PUS | 2022-02-19 18:55:44 |
| wip | +rep Likes to touch children | 2022-02-19 14:09:35 |
| boog vs elliot who poops more | Me2 and agree with b low | 2022-02-15 17:51:54 |
| Duncan Moore | Cam, do you need something? | 2022-02-15 09:40:12 |
| Duncan Moore | Nice ctrl+c ctrl+p comment there Cam. (You forgot how to capitalize the beginning letter of a name. 1st grade English and you failed, imagine being dumber than a 6 year old). | 2022-02-15 09:18:45 |
| c00ly | bot player...only speaking not playing | 2022-02-13 15:00:02 |
| Real-paharo | Niño deja de insultar en los perfiles de la gente, MADURA | 2022-02-13 10:36:11 |
| Trax de drechigi <3 | not understanding english thats so simple is pathetic caralho | 2022-02-13 05:09:01 |
| λ | why so many butthurt kids about csgo? | 2022-02-12 18:42:57 |
| Trax de drechigi <3 | nah i saw that but if you could read you couldnt be so mad. big ass virgin | 2022-02-12 14:02:30 |
| bess | Bot player with 3k hours! | 2022-02-12 12:43:02 |
| Trax de drechigi <3 | like someone asked for ur opinion :) | 2022-02-12 06:19:04 |
| TooR | como jugando eres malisimo,, te dedicas a escribir ala gente en los perfiles sigue asi igual te sube el aim | 2022-02-11 18:24:03 |
| c00ly | silver hero | 2022-02-11 13:30:10 |
| Julia | +REPvery good playerhelpful | 2022-02-11 13:08:03 |
| boog vs elliot who poops more | shuishide | 2022-02-11 06:55:23 |
| Snarbou | dog | 2022-02-11 06:49:34 |
| boog vs elliot who poops more | Cammy wammy do surveillance on me | 2022-02-10 22:54:27 |
| Red11 | hola | 2022-02-10 16:47:03 |
| TroopieHarold | sugondeeze | 2022-02-09 14:21:26 |
| TroopieHarold | sigma sugma | 2022-02-09 14:21:20 |
| TroopieHarold | I am sigma you are sugma | 2022-02-09 14:21:12 |
| TroopieHarold | nib ba | 2022-02-09 13:17:33 |
| TroopieHarold | ♥♥♥♥♥ | 2022-02-09 13:17:27 |
| TroopieHarold | I am gay ♥♥♥♥♥ phobic (this guy) | 2022-02-09 13:17:18 |
| Nelex | hindu go scam tiger tooth butter fly (fn) with broken english and high illiteracy in comunication | 2022-02-08 04:59:59 |
| boog vs elliot who poops more | The creams aka cameras r watching u | 2022-02-08 03:39:54 |
| el demoño | im am's hindu men's | 2022-02-08 03:30:11 |
| Nelex | you are not real | 2022-02-07 10:29:48 |
| Nelex | 76561198187128898 | 2022-02-07 00:49:09 |
| T-Boner | +rep, Professional wallbanger | 2022-02-06 12:51:38 |
| chalujem bagety | add me i have a question | 2022-02-06 04:41:51 |
| Shalom | ur mom is a slut | 2022-02-05 19:25:48 |
| Nelex | you literally ragequit the game at 4 1 10 | 2022-02-05 13:37:09 |
| Я УБЬЮ САМОУБИЙСТВО | play like a silver | 2022-02-05 13:35:58 |
| el matuszinho | u are so ♥♥♥♥♥♥ up | 2022-02-04 17:40:03 |
| 𝕊𝟙𝕃𝕖𝕟𝕥ℤ | what a noob 8 kills on deathmatch | 2022-02-04 16:40:27 |
| 𝕊𝟙𝕃𝕖𝕟𝕥ℤ | ??? wtf | 2022-02-04 06:49:58 |
| pe_ja #freeUkraine | I accept your offer sir | 2022-02-03 13:15:23 |
| Gooz_ | the kok do be big with this man | 2022-01-30 12:34:21 |
| Qzak | +rep friendly person | 2022-01-29 19:01:54 |
| Nelex | tell that to the literal leader of catalan antifa | 2022-01-29 15:37:28 |
| TroopieHarold | this user is actually adolf hitler the leader alt right | 2022-01-29 15:32:26 |
| InToGaming123 | this guy is john wick believe me he will f u in the ass <3 :) | 2022-01-29 11:27:31 |
| Capuno | this user is actually George Clooney, do not trust he is infamous Scientologist!!!!!!1 | 2022-01-29 06:02:05 |
| Nelex | Hello, man ! can you accept friend ? request. I have some thing for you! ! i dont scaming. oplease dont scam me !! i am add for tradeing !!! please, | 2022-01-28 14:04:15 |
| worldwidewalt | added for trade | 2022-01-28 13:26:40 |
| ✟Masked Aristocrat✟ | Prithee tell, who is this one Rhodesia? | 2022-01-27 22:35:03 |
| TroopieHarold | !WARNING! THIS PERSON IS AN ANTI SEXMITE HE IS VERY RUDE TO ISRAEL | 2022-01-27 15:51:49 |
| Nelex | ok | 2022-01-26 01:30:52 |
| TroopieHarold | Sugma balls paganist satanist jew | 2022-01-25 19:19:28 |
| Nelex | this | 2022-01-24 16:57:39 |
| ging | сынишка ♥♥♥♥♥♥♥♥♥♥ | 2022-01-23 14:02:34 |
| Ripper | +rep good boy | 2022-01-23 13:03:18 |
| Nelex | cares | 2022-01-23 05:54:45 |
| men | how | 2022-01-22 16:54:16 |
| ging | сынишка ♥♥♥♥♥♥♥♥♥♥ | 2022-01-22 08:54:24 |
| Nelex | who | 2022-01-22 05:03:55 |
| Johtaja Lehtimäki | Still crying? | 2022-01-22 04:26:24 |
| Trodainus | +rep auttism | 2022-01-21 16:35:31 |
| Johtaja Lehtimäki | Haha bro you must be fun at parties.... | 2022-01-21 09:15:39 |
| Johtaja Lehtimäki | Crybaby mad? | 2022-01-21 08:18:16 |
| сырный шарик | Legend with crazy inventory+rep | 2022-01-20 14:27:01 |
| Nelex | ? | 2022-01-20 11:56:08 |
| сырный шарик | ? | 2022-01-20 09:58:55 |
| OnionMuncher | welp someone else bought it now | 2022-01-14 12:41:33 |
| OnionMuncher | I was asleep bro. Just buy it again if u want it. | 2022-01-14 12:04:14 |
| Johtaja Lehtimäki | Shut the ♥♥♥♥ up kid | 2022-01-14 07:27:12 |
| Nelex | okay ! start with me please | 2022-01-14 04:38:28 |
| Johtaja Lehtimäki | Im gonna make sure that you will suffer painful death and your family too ♥♥♥♥♥♥♥ ♥♥♥♥♥♥ | 2022-01-14 01:58:51 |
| A.D.H.D | +rep vewy good fuwwy fwiend UwU | 2022-01-13 15:02:52 |
| monky | +rep very good gay guy good for ♥♥♥♥ | 2022-01-13 14:38:35 |
| Emmy aest | aeayreueueue??? euur, eyytuey yet yeyetyeyeyeyeyeeeeeeeyy!!!!!!!!!!!!!!!!!!! ueueueyeueyeu UwU | 2022-01-13 14:18:27 |
| Nelex | rusia | 2022-01-11 02:20:27 |
| Nelex | left sucker, the edgy profile picture ♥♥♥♥♥ says. He, for all he knows, has accomplished himself in the eyes of him and himself only. But the truth will never come out of his head. | 2022-01-11 02:20:14 |
| D❤️S[Z] | left sucker | 2022-01-10 13:54:15 |
| Andrej Tatovic | Add me please xD | 2022-01-10 08:29:11 |
| ✪ Blackburn | +rep mental breakdown | 2022-01-07 16:59:05 |
| sexter | knief | 2022-01-07 10:01:00 |
| boog vs elliot who poops more | cammy wammy you are sho clammy :p | 2022-01-05 14:41:27 |
| MarceLo | do you like PAU VALLVÉ - UN SOL RADIANT? | 2022-01-05 11:31:44 |
| Nelex | Who the ♥♥♥♥ do you think you're talking to? | 2022-01-05 08:12:02 |
| Nelex | Well, I'm the only one here... | 2022-01-05 08:11:49 |
| Nelex | you talking to me? | 2022-01-05 08:11:22 |
| Nelex | Then who the hell else are you talking-- | 2022-01-05 08:11:00 |
| Nelex | you talkin to me? | 2022-01-05 08:09:23 |
| IceTea | why the ♥♥♥♥ would anyone be such a bad person | 2022-01-05 07:43:40 |
| boog vs elliot who poops more | If you are on God's side, post this to 10 walls. If you're on the devil's side, ignore it. God will do two things for you tonight. | 2022-01-03 05:02:01 |
| Nelex | Last night a little dancer came dancin' to my doorLast night a little angel came pumping on my floorShe said come on baby, I got a license for loveAnd if it expires, pray help from above, becauseIn the midnight hour, she cried more, more, moreWith a rebel yell she cried more, more, moreIn the midnight hour babe more, more, moreWith a rebel yell more, more, moreMore, more, more! | 2022-01-03 05:01:47 |
| boog vs elliot who poops more | CAMMY WAMMY | 2022-01-03 04:55:40 |
| Nissan GT-R R35 nismo | +rep kam | 2022-01-03 04:53:58 |
| Nelex | "ue ue ue WAAAAAAA ue ue ue ue ue WAAAAAAAAA" | 2022-01-02 16:00:27 |
| Seomate ✔ | https://en.wikipedia.org/wiki/Catalonia_Offensive | 2022-01-02 12:47:52 |
| Nelex | "noooooo dont click on the link noooo its virus !!! " "WAAAAAAA WAAAAAAAAAAAAAAAAA" | 2022-01-01 12:48:35 |
| ❀幻想茶会❀ | 我之前跟你打过csgo | 2022-01-01 01:04:05 |
| Seomate ✔ | English? | 2021-12-31 17:08:03 |
| TroopieHarold | pagan | 2021-12-31 08:04:34 |
| TroopieHarold | My mans calling people christcuck...let me guess you're a "based schizo ♥♥♥♥♥♥♥♥♥" | 2021-12-31 08:04:28 |
| Seomate ✔ | "Catalonia"Spain** | 2021-12-30 22:52:18 |
| doodlebob1989 ∴ | hi I have seen where that pic is from :> | 2021-12-30 14:30:05 |
| Seomate ✔ | https://www.youtube.com/watch?v=hPmJh-Eh_iA | 2021-12-30 10:34:22 |
| λ | jodete ctazy | 2021-12-29 18:56:56 |
| Seomate ✔ | SPAIN** | 2021-12-29 15:02:20 |
| Nelex | ahahhaha hello astro ., | 2021-12-29 11:21:29 |
| zyr | +rep i love ankha too :) | 2021-12-28 18:10:21 |
| λ | sex slave.... | 2021-12-28 18:04:19 |
| Nelex | 1118 | 2021-12-28 08:02:15 |
| λ | qué es esta foto hijo de la grandisima puta | 2021-12-28 05:11:00 |
| Duncan Moore | Please redo your profile. You’re a part of the problem, you’re the reason why we have complete Brain AIDS in our culture and contribute to Sheeple comedy. | 2021-12-28 00:40:03 |
| Nelex | just killed a man...... | 2021-12-26 16:54:46 |
| boog vs elliot who poops more | mama | 2021-12-26 16:33:01 |
| SmegMan | this dude prob got some family problems | 2021-12-25 17:34:54 |
| boog vs elliot who poops more | cmaamamamanamaamammamamam | 2021-12-25 17:28:07 |
| Vertical Flick God ************ | cause your mom is a ♥♥♥♥♥♥♥ ♥♥♥♥♥ | 2021-12-25 17:27:05 |
| Edgar | This guy has extra chromosome | 2021-12-24 15:42:09 |
| Nelex | mad | 2021-12-23 09:56:10 |
| Mestre | catalanes homosexuales | 2021-12-23 09:29:34 |
| e1.e2.e3.e4.e5.e6.e7.e8.e9.e10.e | so mad hahahahahaa | 2021-12-22 16:11:49 |
| Kłopoty Najmana | +rep | 2021-12-22 07:02:58 |
| Nelex | no selec !!nwhat are you doing | 2021-12-22 01:32:00 |
| selec | -rep i hate black people :/ | 2021-12-21 19:23:07 |
| selec | -rep too homosexual | 2021-12-21 19:20:55 |
| Nelex | Ok. | 2021-12-21 07:20:10 |
| Xemi4 | - rep rusher mag p90 | 2021-12-21 06:03:23 |
| λ | catalunya por siempre | 2021-12-20 19:10:58 |
| -Shahzada- | VERY toxic person - PLEASE STAY AWAY - Profile SIGNED | 2021-12-20 17:47:09 |
| Nelex | big chu | 2021-12-20 09:58:21 |
| Nelex | "still mad">just now | 2021-12-19 06:48:12 |
| d0t | so lucky xD | 2021-12-18 13:38:21 |
| ging | can only "cam" to his mommy to ♥♥♥♥ her | 2021-12-18 12:56:15 |
| ging | total trash 6 kills in 30 round, 1 kill for T side over 15 rounds | 2021-12-18 12:55:42 |
| kend | the worst. if u play w/ him - just leave. Don't waste ur time | 2021-12-18 12:54:33 |
| Yuki lee | bot very easy | 2021-12-18 11:54:47 |
| ᛃ | + rep based catalonian and spanish hater | 2021-12-18 06:06:49 |
| Nelex | HAHAHAHA coge un libro.,.,.,, soy muy mas importante de ti.,..., | 2021-12-17 10:10:18 |
| Nelex | inculto y ignorante jajajajajja:V::V:V:.Vv | 2021-12-17 10:10:00 |
| wasni | +rep, bona gent nice inventari | 2021-12-17 08:52:00 |
| NeiL | catalán, inculto e ignorante, imagínate ser semejante basura... coge un libro, nene ^^ | 2021-12-17 07:03:32 |
| siker | -rep clown playing with a friend that cheats 👌🏻 | 2021-12-17 04:56:29 |
| selec | 💜 NUDE.SNAPGIRLS.TODAY/biyik 💜 PRIVATE S*XMAKING LOVE 💜#ライブ配信の再編ありがとうです！#この日のライブ配信は、#かならりやばかったですね！１#万人を超える人が見ていたもんね（笑）#やっぱり人参最高！#まさかのカメラ切り忘れでやら1かしたのもドキドキでした！#今後は気を付けないとね5). .!💖🖤❤#今後は気をライブ配信の再編ありがとうです！#この日のライブ配信は、#１万人を超える人が見ていたも ん（#笑）#やっぱり人参最高！#まさかのカメラ切り忘れでやら1かしたのもドキドキでした #今後は気をライブ配信の再編ありがとうです！（ #笑）#垃圾 | 2021-12-17 00:19:04 |
| Nelex | Ok | 2021-12-13 11:23:13 |
| Johtaja Lehtimäki | So ♥♥♥♥♥♥♥ little sad little ♥♥♥♥♥ who comments on own profile :D | 2021-12-13 06:04:33 |
| Johtaja Lehtimäki | Nah kid stfu | 2021-12-13 05:48:05 |
| Johtaja Lehtimäki | So bad ♥♥♥♥♥ | 2021-12-12 11:51:45 |
| Nelex | says who? | 2021-12-11 05:48:56 |
| Johtaja Lehtimäki | -rep ♥♥♥♥♥♥♥ bad | 2021-12-11 00:55:33 |
| Nelex | How much skill do you have?Z E R O o o o 。 。 . . . . | 2021-12-05 14:11:51 |
| fxoff | -rep bot | 2021-12-01 11:32:10 |
| Nelex | Cry | 2021-11-30 14:37:15 |
| mihi | -rep bot | 2021-11-30 11:05:59 |
| Solder Fumes | I got the glitched name tag working | 2021-11-29 13:08:18 |
| Sneezeloaf | +rep Wtf who are u | 2021-11-29 06:52:01 |
| Nelex | :skull: | 2021-11-28 06:40:00 |
| boog vs elliot who poops more | Cuz he dumb | 2021-11-28 04:59:09 |
| λ | REGGAETTON SAVED MY LIFE!!!! LOOK HOW HERE crazychemistisafagg0t.com | 2021-11-25 13:56:25 |
| piotrek | balls | 2021-11-24 05:24:15 |
| lego idiot | sussy amogus | 2021-11-24 05:03:06 |
| 🌴 Forfeit 🌴 | cringe | 2021-11-23 07:59:28 |
| lego idiot | +rep calls me based | 2021-11-19 05:37:29 |
| piotrek | +rep cute guy... was fun playing with ya mate! btw. can u add me? because i have restriction.... friend of steam........... i dont know why..... btw () you have good skins aha.... mind if we trade a bit?... we could discuss in chat you know,... aha..... | 2021-11-18 09:06:26 |
| Nelex | +rep cute guy... was fun playing with ya mate! btw. can u add me? because i have restriction.... friend of steam........... i dont know why..... btw () you have good skins aha.... mind if we trade a bit?... we could discuss in chat you know,... aha..... | 2021-11-17 13:37:17 |
| ok | +rep no scam | 2021-11-17 12:17:33 |
| boog vs elliot who poops more | +rep commenting on your profile now | 2021-11-17 02:37:42 |
| Nelex | You should give me all your life savings... NOW!!! | 2021-11-13 04:25:32 |
| Dog Nog | You should killbind... NOW!!! | 2021-11-13 01:55:30 |
| LEGEND OF ALL | 12 year autistic ♥♥♥♥ pre made with another | 2021-11-12 16:54:08 |
| danielo | -rep | 2021-11-12 16:48:49 |
| mr busdriver | anger issues dog | 2021-11-12 16:27:12 |
| Nelex | Commento sul profilo di cam | 2021-11-12 04:22:27 |
| Nelex | how he | 2021-11-11 13:07:05 |
| cinderelladarko | he really said | 2021-11-11 12:32:50 |
| Vladimir | Toxic as hell, not a fun dude having a game with | 2021-11-06 18:18:14 |
| Nelex | 1384 ms : cam (26 fps mode) | 2021-11-06 17:49:18 |
| Lady Noctowl | Terra Lliure | 2021-11-05 07:40:45 |
| Nelex | cry | 2021-11-04 01:11:33 |
| juskin (ka$E) | stop licking spanish boots....you will get foot in mouth diease...tosser. | 2021-11-03 19:24:22 |
| λ | crazychemist estás SIENDO SANCIONADO POR LOW SOCIAL CREDITYOU WILL BE PUBLICLY EXECUTED | 2021-11-03 18:19:43 |
| ๖ۣۜ.XέON | Stfu bot | 2021-11-03 08:52:17 |
| juskin (ka$E) | HAIRY ,SMELLY AND OVERWEIGHT SPANISH BATHROOM CLEANER.... | 2021-11-03 08:31:16 |
| ENEZ | SIUUUUUUUUUUUUUUUUUUUUUUUUUUUUUU YEAH IT'S ME RONALDO I NEED 22DOLLARS I FORGOT MY WALLET AT TOILET SEND ME 22 DOLLARS I WILL SEND YOU BACKKK | 2021-11-03 07:49:17 |
| Nelex | CATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCAT | 2021-11-02 19:15:12 |
| Shifti | 👎 not very kind 👎 | 2021-11-01 07:20:56 |
| Nelex | hello im underage boy, please gift me game 😋😇 | 2021-11-01 06:00:29 |
| lego idiot | send me your ♥♥♥♥ | 2021-11-01 05:36:07 |
| kr1sss28 | - rep why u ask my nudes? | 2021-10-30 07:01:02 |
| Nelex | +rep not cheater | 2021-10-29 10:18:15 |
| Kazu | yo bro dont even bother the steam chat is ♥♥♥♥♥♥♥ autism mfs r so dense they dont understand | 2021-10-29 06:49:39 |
| Libre BOT Niles | -rep cheater | 2021-10-29 06:32:44 |
| Nelex | ? | 2021-10-28 15:05:21 |
| regular ass ravioli | casual monthly check up | 2021-10-27 13:19:18 |
| Nelex | ok | 2021-10-26 17:57:43 |
| ranker93 | You ♥♥♥♥♥♥♥ ♥♥♥♥♥ | 2021-10-26 17:54:13 |
| 性欲 | I was spamming shrek ASCII | 2021-10-26 14:49:00 |
| piposouli | 你被征召保卫中国祖国的西南边境。将派一个小组将他带到防御基地。祝你好运。冰淇淋 | 2021-10-25 16:36:29 |
| Nelex | name checks out | 2021-10-23 16:37:02 |
| VR38DETT | baiting with his toxic friend :D | 2021-10-22 16:09:02 |
| cinderelladarko | do u like radiohead | 2021-10-15 22:47:04 |
| Brontosauro | ratto | 2021-10-15 17:54:31 |
| Brontosauro | sei un bot del cazzo stai zitto schifoso | 2021-10-15 17:54:26 |
| Chop Huey | DirtyTwitch - spot for adult gamers who want to see something more than just gaming Streams.Watch Girls play CSGO, masturbate and fulfill all your dirty desires. Click this link for free. - [REDACTED] | 2021-10-12 18:48:46 |
| 76561199074967065 | I just wanted you to give your opinion, it's not for sale :v | 2021-10-11 16:47:09 |
| 13Iossom | We can talk about your skins souvenir | 2021-10-11 06:38:28 |
| shaggy's gout | from retakes? really? ur that salty? lolll | 2021-10-10 17:52:59 |
| kabel | (TRANSLATE) wieder einfach heute du hurensohn | 2021-10-08 15:28:08 |
| Babacii>Fortinayt | (TRANSLATE) wieder einfach heute du hurensohn | 2021-10-08 15:24:57 |
| cosmic sitcom | phag | 2021-10-07 23:05:04 |
| cosmic sitcom | literally who | 2021-10-07 23:04:39 |
| regular ass ravioli | will you buy me the best emoticon ever with a gamma 3 case? | 2021-10-06 03:34:20 |
| K0yom1 | 50 rmb on buff, there is a ww vp nip ump selling for 30 rmb on buff | 2021-10-06 02:29:20 |
| K0yom1 | thx bro! | 2021-10-06 01:05:42 |
| barb | i open hundreds of cases a day its bad :( | 2021-10-04 10:45:16 |
| Nelex | thanks it means a lot to me | 2021-10-02 16:11:30 |
| barb | okay | 2021-09-28 16:21:00 |
| Nelex | motor head | 2021-09-28 12:59:31 |
| barb | to open dummy | 2021-09-28 10:44:27 |
| 🅾🆀🆄🅴🅸 | J O P U T A | 2021-09-24 12:53:39 |
| enigmazo ✪ | A N O R M A L | 2021-09-23 15:26:30 |
| DIVINERAPIER | +rep nice player and nice person | 2021-09-23 05:33:27 |
| enigmazo ✪ | me vas a comer los huevos con tu madre retrasao | 2021-09-22 11:45:19 |
| regular ass ravioli | because dead by daylight :( and the disrespectful summons, maybe one day I'll get better satanic art | 2021-09-21 23:35:23 |
| speed | cam (farting hours) | 2021-09-20 07:25:38 |
| enigmazo ✪ | payaso | 2021-09-19 15:06:42 |
| regular ass ravioli | it's going good. beloved wife, how are you?? | 2021-09-18 18:50:27 |
| ☆kov | what.. | 2021-09-17 21:31:17 |
| ☆kov | +rep ujel:ujel:ujel:ujel:ujel:ujel:ujel:ujel:ujel:ujel:ujel:ujel:ujel:ujel:ujel:ujel:ujel:ujel:ujel:ujel:ujel:ujel:ujel: | 2021-09-17 21:31:10 |
| RealShacharMlgBoi | +rep friendly teammate was fun to play. i hope you play with him too | 2021-09-17 10:58:15 |
| Bell Beakeroïd | >noob feeding every round, tk you at the start of every round + can't shut his virgin inbred mouth in VC THEN proceed to cry in chat when you finally retaliate lmfao | 2021-09-13 11:58:42 |
| я люблю жизнь | +rep | 2021-09-12 18:10:33 |
| Stolz | get the f4ck out of my comments | 2021-09-12 04:01:31 |
| Stolz | who the ♥♥♥♥ are you f3king loser | 2021-09-11 03:56:50 |
| fsy banditcamp.com | 0_0 | 2021-09-10 14:18:03 |
| chikin | https://www.youtube.com/watch?v=fupccXjSBII Leaked video of Joe Biden's questionable interaction with children. 👀 | 2021-09-10 09:26:05 |
| fsy banditcamp.com | really weird guy he knows he was lucky but he cant saying i am | 2021-09-09 15:11:23 |
| fsy banditcamp.com | yea im playing tryhard at warmup =_= i got 27 kills u 20? | 2021-09-09 15:10:40 |
| fsy banditcamp.com | or we lost cuz of your lucky shots 0_0 | 2021-09-09 14:27:39 |
| fsy banditcamp.com | only lucky shots | 2021-09-09 13:06:48 |
| dark angel+++ | reported | 2021-09-08 19:54:40 |
| Dog Nog | amazing played | 2021-09-07 08:08:56 |
| Life Forever | Go to school son of slut | 2021-09-06 05:48:52 |
| Life Forever | https://www.faceit.com/ru/csgo/room/1-7a8bb5ee-4625-4af7-bbfc-f44f4d03d101/scoreboard amazing played | 2021-09-05 04:12:25 |
| selec | MANEIRO O DEMO E AS PUXADA KKKKKKKKKKKKKKKKKKKKKKKKK AINLOCK MOSTRO LIXO. NAO VAI SAIR DO XERIFE NUNCA ARGENTINO DOENTE... VC FEDE CARA FEDE. E UNICA PALAVRA A VC LIXO...... SEM HACKER NAO JOGA UM OVO PRECISA DISSO PRA GANHA O GAME RETARDADO LIXO. GG DEMO PARA FORUM TE REPORTAR LIXO ARGENTINO PARASITA E AINDA E POBRE. FEDE | 2021-09-04 03:44:10 |
| ENEZ | ♥♥♥♥ you cam, i love you so much. happy birthday | 2021-09-03 13:45:48 |
| regular ass ravioli | I love you more cam, I'll never forget the day we got married | 2021-09-01 03:49:46 |
| xCeeD | signed by xCeeD:) | 2021-08-31 16:37:23 |
| /T800/ANGREST/ | i liked this guy | 2021-08-31 11:04:19 |
| men | red | 2021-08-30 12:06:35 |
| regular ass ravioli | love the toilet roll you caught in 4k cam | 2021-08-29 04:56:00 |
| Rostislave♂ | Kys | 2021-08-28 04:56:11 |
| regular ass ravioli | +rep 6/6 would give u 66 nuggets and more | 2021-08-27 03:35:41 |
| durak ebuchiy | сum | 2021-08-20 10:05:44 |
| Nelex | hahahha who is dog who is cry ahah i dont know., who he is. | 2021-08-17 09:30:45 |
| QUEEEEEEEEENSLANDAAAAAA | -rep cried because he got ♥♥♥♥♥♥♥ owned by an LEM when he is a gold nova. No skill, no life and no father figure in his life! KEK | 2021-08-14 11:56:48 |
| ENEZ | he said virgin to me and i cried all night in my bed-rep | 2021-08-13 15:10:51 |
| florida jhit | tus muertos btw | 2021-08-12 14:15:58 |
| caterpillaronale4f | sorry man my brother came on my pc the cheeky ♥♥♥♥! | 2021-08-12 10:21:35 |
| 単純 | -rep cheats onfire | 2021-08-12 05:43:47 |
| Curva Sur | +rep | 2021-08-11 14:41:52 |
| Curva Sur | Duras palabres | 2021-08-11 13:56:27 |
| caterpillaronale4f | why you commenting on my ss are you still mad kid? kinda toxic if you ask me | 2021-08-11 06:17:35 |
| ᴱᶻⱽⁱᵈʸᵃᴳaMing | -repe | 2021-08-11 05:50:30 |
| ᴱᶻⱽⁱᵈʸᵃᴳaMing | +rope | 2021-08-11 05:04:48 |
| imrottenn | -rep wallhack | 2021-08-11 04:25:22 |
| ENEZ | not virgin anymore | 2021-08-11 03:12:10 |
| elbokeron | dude even after 1 week? u still mad? xd typical congo dude | 2021-08-10 09:19:01 |
| Nelex | :O | 2021-08-10 09:01:02 |
| DADDYJARMO | +rep biggest ♥♥♥♥ ive ever sucked | 2021-08-10 03:35:10 |
| Nelex | -rep wallhack toxic | 2021-08-08 12:57:46 |
| imrottenn | -rep wallhack toxic | 2021-08-06 11:57:24 |
| Ljubo | +rep best IGL with 200iq plays. PUGS are easier than ever under his guidance. | 2021-08-06 08:15:36 |
| elbokeron | LOL imagine thinking congo is superior | 2021-08-05 15:14:42 |
| elbokeron | -rep retarded and toxic ♿ ♿ ♿ | 2021-08-05 10:12:47 |
| Suck My Triceps | Smart and handsome Congo, the Democratic Republic of the boy | 2021-08-04 10:54:31 |
| Jessica ❤ | -rep fat pedophile go play minecraft | 2021-08-03 13:36:49 |
| Nelex | ● cam : program | 2021-08-02 11:52:26 |
| Feitan | -rep go play minecraft ♥♥♥♥♥♥♥ ♥♥♥♥♥♥ | 2021-07-31 11:15:27 |
| Ljubo | shatap noob | 2021-07-27 07:47:41 |
| Gemirill | -rep | 2021-07-23 09:17:59 |
| Fryers | sexx me | 2021-07-17 06:40:42 |
| Ljubo | how to unvirgin a guy named s3ns3I step 1 - you cant | 2021-07-13 05:16:57 |
| s3ns3I | https://trovo.live/clip/lc-3701925920724992425?ltab=videos Here's for you. Like I said, first brain find and then you can say something. As I can see, it's only some idiot behind that steam acc., who don't have nothing best to do, then molesting people on social media. | 2021-07-11 06:38:24 |
| s3ns3I | Enjoy in your sad / sorrow life, get yourself brain first and then you can talk about what you want. ;) | 2021-07-11 06:33:16 |
| s3ns3I | -rep | 2021-07-10 19:45:04 |
| AlfaQ | I:/ | 2021-07-10 17:21:06 |
| cerka56 | -rep toxic and bad teamplayer | 2021-07-10 12:27:37 |
| zerit | noob xd | 2021-07-10 12:16:14 |
| Kraken | -rep ♥♥♥♥♥♥♥ brainless | 2021-07-09 10:47:02 |
| Nelex | no problem. you are welcom e. | 2021-07-09 04:47:05 |
| Ljubo | cam I UPVOTE WORKSHOP SKIN | 2021-07-09 01:49:27 |
| Nelex | AHHAHAHAHAh cry bot. you got carried by a closet bot | 2021-07-06 04:20:32 |
| - $ɛδɛ vacan†ɛ | -rep ♥♥♥♥♥♥♥ noob. | 2021-07-05 12:49:58 |
| Lucifer | +rep friendly | 2021-07-05 11:01:32 |
| cinderelladarko | cam how do the biggest brainlits in the universe always find your profile | 2021-07-05 01:46:50 |
| cinderelladarko | its an unturned game ban i forced with unity so I could tell people I got overwatched you f.ucking moron | 2021-07-05 01:45:36 |
| blackxgod | Boosted bot, doing 10-28 | 2021-07-04 12:38:40 |
| Tijan | boring profile | 2021-07-02 16:10:59 |
| Sieg Kyle | Nice vac ban grace. Can't even play a game normally? | 2021-07-02 05:04:23 |
| cinderelladarko | woah did you actually win 16-4 thats insane :mind_blowing: stfu i would bully you in school | 2021-07-01 22:45:36 |
| Sieg Kyle | Bruh who the ♥♥♥♥ even are you lmao | 2021-07-01 17:30:26 |
| bid0n | backup acc | +rep huge milf | 2021-06-28 07:21:58 |
| Potiumbidenick | +rep nice guy | 2021-06-27 11:43:11 |
| Beleza | I legit don't know who you are, and I really don't care about the one game I smashed you or you smashed me. Good luck in your future games tho | 2021-06-26 14:38:17 |
| Beleza | who are you ? | 2021-06-25 06:29:52 |
| Frost | so cringe are you 40 yo or what boomer | 2021-06-24 16:59:41 |
| Frost | 2500 hrs silver im weak | 2021-06-24 12:02:08 |
| λ | this mtherfcker is gonna destroy that exam | 2021-06-10 14:55:05 |
| Nelex | Dragon, dragonDragon, DragonballDragon, dragonDragon, DragonballDragon, dragonDragon, DragonballDragon, dragonDragon, DragonballChi sei, Goku non lo saiPerò presto lo scopriraiE poi tu scompariraiAndrai nell'immensitàLaggiù, incontro all'oscuritàFinché tutto cambieràUna nuova realtàCon le sue veritàScaverà nel tuo passatoE guardando più in làIl tuo cuore sapràRitrovare DragonballWhat is my destiny, DragonballIo so che tu lo sai, DragonballPerché non c'èUn drago cheSia grande come teWhat is your destiny, Dragonball (what's your destiny)Tu non ce lo dirai, Dragonball (what's my destiny)Ma torneraiE già lo saiChe il buio vincerai | 2021-06-04 18:25:34 |
| Nelex | DragonballDragon, dragonDragon, DragonballDragonballDragon, dragonDragon, DragonballDragonballDragon, dragonDragon, DragonballDragonballDragon, dragonDragon, DragonballL'oscurità splendenteDiverrà con tePerchéLa tua fiamma oramaiÉ più ardente che maiWhat is my destiny, DragonballIo so che tu lo sai, DragonballPerché non c'èUn drago cheSia grande come teWhat is my destiny, Dragonball (what's my destiny)Woowowo Dragonball (what's your destiny)WoowoWoowoWowowoWhat is your destiny, Dragonball (what's your destiny)Tu non ce lo dirai, Dragonball (what's my destiny)Ma torneraiE già lo saiChe il buio vinceraiDragonballDragon, dragonDragon, DragonballDragonballDragon, dragonDragon, DragonballDragonball | 2021-06-04 18:25:24 |
| cinderelladarko | smoked | 2021-06-04 11:20:22 |
| cinderelladarko | i cant believe that people actually break the law man wtf | 2021-06-03 11:14:34 |
| ♣Jonsson♣ | cam you sucked man, you got destroyed | 2021-06-02 14:45:23 |
| λ | stop playing ffffvck11ng csgo | 2021-06-01 09:08:20 |
| Ljubo | cam 2 hours ago View all 803 comments < 1 2 3 4 5 6 ... 134 >Comments Subscribe to thread (?) | 2021-06-01 05:56:05 |
| Nelex | peek | 2021-05-31 11:32:09 |
| Ljubo | hi mate, can you add me? I really wanna scam you but you're gonna have to add me first | 2021-05-30 11:59:06 |
| Nelex | hi mate, can you add me? I'm a social outcast and have problems socializing with people in real life | 2021-05-30 08:24:48 |
| Ljubo | amogus | 2021-05-28 14:03:21 |
| Ljubo | xD commit neck rope | 2021-05-26 11:26:02 |
| Ljubo | negative | 2021-05-26 04:04:33 |
| Ljubo | bosnian*** and i still didnt ask | 2021-05-25 15:37:07 |
| Ljubo | i didnt ask | 2021-05-25 13:02:22 |
| Ljubo | b | 2021-05-25 07:41:30 |
| james | -rep cheats | 2021-05-21 18:19:26 |
| X™ | ya me la he quitado no me rajes porafvor | 2021-05-18 13:33:17 |
| Lady Noctowl | tu mas | 2021-05-16 11:04:41 |
| ✝una | lol | 2021-05-16 07:35:36 |
| ✝una | .d | 2021-05-16 05:21:48 |
| ✝una | -rep id.io..t :) | 2021-05-16 03:13:52 |
| D0kt0r17 2.0 ツ | +rep great teammate | 2021-05-15 13:00:49 |
| Nelex | camera | 2021-05-13 16:17:53 |
| λ | camera | 2021-05-13 14:27:44 |
| ☆kov | camera | 2021-05-13 14:21:20 |
| Nelex | camera | 2021-05-13 06:52:20 |
| λ | when THA IMPOSTER IS SUS? | 2021-05-12 18:50:45 |
| ギボン長老 | -rep stupid noob | 2021-05-10 15:35:28 |
| Fryers | briish? !!! | 2021-05-07 12:52:07 |
| Äggbert 2 | british ♥♥♥ | 2021-05-07 12:38:03 |
| Fryers | c UUUUUUU | 2021-05-06 10:12:43 |
| protective | yo dude, send me a friend request, lets play together | 2021-05-05 22:14:16 |
| 8439678638334 | +rep | 2021-05-05 11:54:40 |
| Giga Chad | +rep insane skins | 2021-05-05 00:57:07 |
| cinderelladarko | just got done smoking that pack | 2021-05-04 20:20:17 |
| Kid Bengala | WHITE SLAVE ♥♥♥♥♥♥ N+I+G+G+E+R | 2021-05-04 13:03:54 |
| Kid Bengala | WHITE DUMP | 2021-05-04 13:03:22 |
| Kid Bengala | n+e+g+r+o | 2021-05-04 13:03:02 |
| Kid Bengala | negro | 2021-05-04 13:02:50 |
| Kid Bengala | "Cam"? more like ♥♥♥ | 2021-05-04 12:56:28 |
| Fryers | ♥♥♥ u i mean it like sex you | 2021-05-04 09:34:18 |
| Lady Noctowl | fav si me ç | 2021-05-03 16:11:37 |
| anylvl | ♥♥♥♥ you noob | 2021-05-03 10:44:15 |
| Fryers | sexy | 2021-04-29 15:43:15 |
| BhoPpSkripes | -rep puta rata de mierda 2300horas y campeando con una negev ya me joderia | 2021-04-29 10:43:45 |
| 76561198532419250 | added to talk | 2021-04-28 13:15:46 |
| 76561198532419250 | +rep | 2021-04-28 13:15:41 |
| ✪Tetsurō | Im not talking to you ♥♥♥♥♥♥♥, ♥♥♥♥♥♥♥ idiot. Your trying to scam me. | 2021-04-28 12:07:23 |
| ganhar raizes | toxic???manito porque manito nem falei nada manito | 2021-04-24 15:15:59 |
| λ | Let the bodies hit the floorLet the bodies hit the floorLet the bodies hit the floorLet the bodies hit the floorBeaten why forCan't take much moreHere we go!Here we go!Here we go nowOne - nothing wrong with meTwo - nothing wrong with meThree - nothing wrong with meFour - nothing wrong with meOne - something's got to giveTwo - something's got to giveThree - something's got to give now | 2021-04-24 11:53:53 |
| WiSdom_gc | -rep, cheater | 2021-04-24 10:25:37 |
| Aaron | wall hacker | 2021-04-24 10:25:25 |
| Nelex | no more cam.i have surpassed that identity.... he is not me any more........... | 2021-04-24 05:13:55 |
| ganhar raizes | manito tu tas bien?? | 2021-04-23 17:19:25 |
| freejar | -rep bottt | 2021-04-23 11:54:35 |
| dream | униженая девочка | 2021-04-22 05:20:19 |
| freejar | -rep idiot | 2021-04-21 13:58:57 |
| Fuchs | hell yeah where and when? | 2021-04-19 11:46:01 |
| Fuchs | hi mate, can you add me? just for a quick chat | 2021-04-19 11:30:45 |
| 1T Michel Iksdeeh | u are trash | 2021-04-14 02:09:59 |
| λ | wanna ♥♥♥♥ me in the ass while playing gta v? 😳😳😳 | 2021-04-12 17:19:05 |
| Nelex | hi mate, can you add me? just to steal your account because im a lazy fk and can't work for my own money | 2021-04-12 07:04:35 |
| Gataur | hi mate, can you add me? just for a quick chat | 2021-04-11 18:48:10 |
| Armar༄ | You* | 2021-04-09 00:23:58 |
| Armar༄ | Yiu have my impersonator in friends list | 2021-04-09 00:23:50 |
| ellie. | femboys aren‘t gay aslong as you don‘t see the thing. Cus then it also be a girl so its basically schrödinger‘s boner | 2021-04-06 03:42:54 |
| Chop Huey | +rep Boards of Canada connoisseur | 2021-04-05 20:10:58 |
| damianluck925 | what yor twitter then f uckign bosnian | 2021-04-05 11:02:40 |
| Nelex | AHAHAHHAHAHAHA | 2021-04-04 08:14:44 |
| cinderelladarko | For some odd reason I cant scam you please send me a friend request | 2021-03-26 10:21:42 |
| Nelex | Hey can you add me? I can't add you, idk why | 2021-03-21 17:24:51 |
| Mafiyozi | cum | 2021-03-21 14:50:07 |
| Shad0w | <3 | 2021-03-19 15:41:56 |
| Mikelica | no | 2021-03-18 16:56:56 |
| Mikelica | cam more like cu_m | 2021-03-17 14:34:51 |
| m. | JEBANY SMIEC | 2021-03-16 10:50:01 |
| Mikelica | el jenjivre se come | 2021-03-15 13:50:05 |
| Mikelica | UwU | 2021-03-15 05:28:32 |
| Mikelica | La camara de blender de perfil LULW | 2021-03-12 16:54:03 |
| Никитка про | ♿-Rep uncomprehending bot♿ | 2021-03-12 15:28:57 |
| source 2 official test profile | cam just now | 2021-03-11 09:58:27 |
| source 2 official test profile | camwhores4sale.com | 2021-03-11 09:53:22 |
| . | Halt lieber die fresse bevor du bomben kriegst | 2021-03-08 12:03:57 |
| florida jhit | aparte pedófilo | 2021-03-04 12:31:57 |
| florida jhit | pls tie a noose and do 180 ollies on a ski lift | 2021-03-04 08:27:36 |
| Keris | +Rep kissed me on the lips and i liked it | 2021-03-03 12:26:17 |
| loseloveloselove | Add me u, i have limit for add, im collector rare skins cs go i have very good offer for u | 2021-03-02 06:33:27 |
| loseloveloselove | added 4 trade | 2021-03-01 22:02:43 |
| patrykdawg | xd | 2021-02-28 07:23:29 |
| Lady Noctowl | çrazi çabroooon hazte tuiter | 2021-02-25 06:33:19 |
| source 2 official test profile | cam ♥♥♥♥♥ | 2021-02-24 11:00:12 |
| 🄰🄿🅺🅂🄿🄰🄸🄽 | -REP Chusma tarada enemiga de su propio pais. Un lastre, un escollo. | 2021-02-21 12:33:44 |
| cinderelladarko | facts | 2021-02-20 17:03:47 |
| jordan | +rep pro player | 2021-02-19 12:58:29 |
| cinderelladarko | lol! your mom! hahaah thats so funny | 2021-02-18 10:00:39 |
| λ | haber si me ç | 2021-02-16 14:58:33 |
| Rostislave♂ | -rep kys 2.3k hours noob | 2021-02-16 05:10:49 |
| Snarbou | Le plus gros cancer de steam ! | 2021-02-15 06:55:08 |
| Fryers | ok frind | 2021-02-13 08:21:23 |
| Fryers | ma lov why you unfrind me im sad | 2021-02-13 07:30:55 |
| The_Adam_Great_Gamer_55 | -rep gets orgasm after winning 2v5 match | 2021-02-12 14:15:58 |
| Zé Beselgas | That guy that i like too say "rich but so ♥♥♥♥♥♥♥ noob hahaha" | 2021-02-11 10:41:41 |
| Dog Nog | spooky | 2021-02-11 01:38:24 |
| GranKo | +rep | 2021-02-11 01:36:28 |
| pce | yea except im 17 you ♥♥♥♥♥♥♥ doofus | 2021-02-09 16:38:01 |
| pce | add my discord lets talk buckotobias#7592 | 2021-02-09 13:48:09 |
| pce | TIL italians are still ♥♥♥♥♥♥♥ stupid and couldnt tell a joke for their own life. | 2021-02-09 11:49:51 |
| pce | # broke ni66a alert....... LOL | 2021-02-09 01:14:56 |
| pce | still dont know who u r. 😂 | 2021-02-06 16:18:20 |
| ImEthan | u r nob | 2021-02-05 03:37:59 |
| pce | -rep edgelord wannabe | 2021-02-03 00:55:01 |
| florida jhit | quieres sandwich de puñetazos? | 2021-01-30 09:25:31 |
| cinderelladarko | shut the dang up idiot ur unfunny | 2021-01-29 09:51:58 |
| add my new steeam :( | go play minecraft | 2021-01-29 08:50:46 |
| add my new steeam :( | i ♥♥♥♥ you mom baby dont cry :( | 2021-01-29 08:50:40 |
| cinderelladarko | d in my mouth - urgent listen to its so cool | 2021-01-29 08:39:21 |
| Lwahrani | why u are gay | 2021-01-25 05:41:58 |
| Dest1l | Such a liar i was better than you btw your score was 5 2 16 all the game :) | 2021-01-24 13:28:18 |
| Dest1l | -rep cringe idiot who is spaming -rep | 2021-01-24 10:32:51 |
| pce | idk u bro tf u commenting on an old acc 4? | 2021-01-23 22:49:59 |
| xo | who tf even are you commenting on my profile lol. weirdo. | 2021-01-23 20:45:09 |
| pce | who tf even are you commenting on my profile lol. weirdo. | 2021-01-23 01:17:36 |
| Shmigel | -rep cryyyyyyiiiiinnnnnngggggg | 2021-01-22 14:11:25 |
| cinderelladarko | hey cam, when you get the chance can you return my crockpot? preferably by next friday as Im making a pot roast for a family event next weekend. Thanks | 2021-01-22 13:04:24 |
| ? | danish cocker not recommended for long term use | 2021-01-20 14:52:21 |
| Falqion | -rep easily triggered omegalul | 2021-01-20 06:00:23 |
| Toby | ok | 2021-01-20 03:58:49 |
| ハチ | Someone's mad uwu | 2021-01-19 15:19:40 |
| Marinius | hey, i cant send you friend request, so can you add me please? its urgent | 2021-01-15 16:49:42 |
| .fil | accept friend request men!!1! | 2021-01-15 14:00:47 |
| Яна Цист | garbage that is boosted with a cheater in wingman | 2021-01-15 13:04:24 |
| Чупик | Good player | 2021-01-15 12:51:47 |
| пурбо тудж | кидает в лс ссылки с вирусами | 2021-01-14 14:39:02 |
| пурбо тудж | -rep noob, new player 76.9 ч. за последние 2 недели | 2021-01-14 14:38:35 |
| florida jhit | arriba la falange | 2021-01-14 12:46:16 |
| florida jhit | -rep pédofilo, que te pasa en la cabeza indepe de mierda | 2021-01-14 12:46:06 |
| d4vied4rko | this dude needs to get a life | 2021-01-14 08:52:36 |
| BEST ONE | +rep mucho sexsi amigo <3 | 2021-01-13 13:31:30 |
| Fryers | ass | 2021-01-13 09:22:22 |
| Fryers | love sex | 2021-01-13 08:56:43 |
| 420_69 | lowered to minimum I can go for | 2021-01-12 04:17:03 |
| 1230 | good but toxic .. looking for a problem where it is not .. | 2021-01-11 14:21:34 |
| d4vied4rko | +rep extremely racist | 2021-01-10 13:08:11 |
| 478vurex | mad noob | 2021-01-09 11:55:06 |
| cinderelladarko | loli squad has come to arrest you for pedophilia! | 2021-01-08 21:39:42 |
| speed of Gato | cam 6 Jan @ 8:29pm 2017: Lil Peep2018: XXXtentacion2019: Juice wrld2020 Pop Smoke ;( WHY WORLD2021: cam | 2021-01-08 15:40:49 |
| speed of Gato | my favourite comedian, you should see him playing counter strike and have the laugh of your life | 2021-01-08 15:36:36 |
| ye | Little stupid noob | 2021-01-07 14:22:36 |
| 🙏 | Talented Player, all is team mates fault he is best :) #CAM2021 #CAMROADTOMAJOR2021 | 2021-01-07 11:27:50 |
| ᴵᵃⁿ | Lamentamos informarle de que su Tarjeta de Crédito ha sido denegada, ninguna de sus últimas compras será procesada, y sera archivada a nuestra lista de Actividades sospechosas. Para desbloquear la Tarjeta para su posterior uso, por favor confirmé sus compras.El Listado es el siguiente:> 3x consoladores monster dragon (15') - $ 89.99> 5x Kits de consoladores - $ 299,99> 50x Condones Magnum (XL) - $ 24.45> 1x Lubricante Cummies 750ml - $ 19.99> 1x Cuenta Premium En www.gayandore.com - $ 49.99> 1x Entrada club Gay Spa - $ 39.99> 1x Membresía de 2 años En www.MeetGayAnd♥♥♥♥.com - $ 99.99> 1x Libro "Guía para los homosexuales #1" - $19.99> 1x Libro "Guía para los homosexuales #2" - $19.99> 1x Libro "Guía para los homosexuales #3" - $19.99> 1x Libro "Guía para los homosexuales #4" - $19.99> 1x Libro "Guia para los homosexuales #5" - $19.99 | 2021-01-07 03:57:49 |
| ye | Estoy a punto de masticar a todos tus familiares y amigos cercanos | 2021-01-06 12:20:54 |
| -الموت | cam mum died | 2021-01-06 10:43:08 |
| -الموت | -rep toxic stuppid kid | 2021-01-06 09:31:00 |
| Trabis | -so toxic | 2021-01-05 15:02:15 |
| Srto Gallego | -rep toxic | 2021-01-05 14:35:27 |
| ye | Hermano, y este tan comentario tan gratuito que me pones cuando no te he dicho nada ni a ti ni a nadie de tu equipo? mmm ok... | 2021-01-05 14:32:55 |
| Tutel with hat | -rep bot | 2021-01-04 11:30:58 |
| DatWut? | Cheers for covering my back man.Really didn't want to AFK half of the game, but... yeah, real life doesn't stop because of games | 2021-01-03 08:41:55 |
| Dog Nog | cool pige | 2021-01-03 07:01:06 |
| Dog Nog | yes | 2021-01-03 05:22:43 |
| men | "Your name is literally cs.money" He the site | 2021-01-03 05:13:50 |
| KingJoshOne | -toxic player | 2021-01-02 11:36:50 |
| fge]r[pwe[]h;swghetr[ | hahahahah noob,shut up and cry | 2021-01-02 04:51:28 |
| men | no | 2021-01-02 04:00:52 |
| men | cu,,,,m | 2021-01-02 03:04:46 |
| men | +rep. ,, funy kdi | 2021-01-02 02:57:20 |
| ✪ 𝐓𝐡𝐞𝐢𝐬 ✪ | Cry like a baby kid | 2021-01-01 15:26:19 |
| Tess Tickle | Cry more :D | 2021-01-01 11:05:48 |
| Tess Tickle | My bio looks nice :D | 2021-01-01 06:08:33 |
| Tess Tickle | -rep idiot | 2021-01-01 01:05:52 |
| Akimbo | ######_____________________________________akimbo_____________________________________##______________________________________######___________________________________#######___________cam___________________#########__________######________________###_######__________######_______________###__######___________####_______________###___######______________##################____######______________##################$$$#######______________#################____######________________###_______#####_____######_______________###_______#####______######______________###________#####______######_________#######_________##########_##############__ | 2020-12-31 11:32:04 |
| Akimbo | i hope you have a nightmare that you lost your pretty awesome inventory | 2020-12-29 16:20:46 |
| Tess Tickle | -rep noob | 2020-12-29 15:42:02 |
| mixN | Who the ♥♥♥♥ even are you, haha. We never played together. | 2020-12-29 14:18:58 |
| Tess Tickle | -rep noob | 2020-12-29 04:57:23 |
| Tess Tickle | -rep noob | 2020-12-29 04:50:12 |
| Tess Tickle | -rep noob | 2020-12-29 04:42:10 |
| Tess Tickle | -rep noob | 2020-12-28 11:16:58 |
| Dog Nog | This comment is awaiting analysis by our automated content check system. It will be temporarily hidden until we verify that it does not contain harmful content (e.g. links to websites that attempt to steal information). | 2020-12-28 08:57:37 |
| wip | This comment is awaiting analysis by our automated content check system. It will be temporarily hidden until we verify that it does not contain harmful content (e.g. links to websites that attempt to steal information). | 2020-12-28 08:50:29 |
| rezyqe | i don't leave idiot | 2020-12-26 17:17:40 |
| rezyqe | go sell all you skin and go buy ♥♥♥♥♥♥♥ skill noob | 2020-12-26 13:55:47 |
| cinderelladarko | you like big penis? | 2020-12-25 17:59:42 |
| cinderelladarko | oh hell naw they on dat spinch bop shi | 2020-12-23 22:31:54 |
| ✪ Undaunted | who tf are you | 2020-12-21 20:13:37 |
| Dark | +rep great trader, 10/10 would trade again | 2020-12-21 15:01:07 |
| Dark | Would you be interested in my st mw cz cw with a dh 2014 fanatic holo on the handle? | 2020-12-20 15:05:48 |
| Dark | love your taste in skins | 2020-12-20 15:02:11 |
| Bambo32 | ten co ukradł rodzicom kase z portfela na skrórki do csa XDD | 2020-12-20 05:45:34 |
| ;)) | true denmark man | 2020-12-18 19:47:41 |
| Estaw1n | skin yes - skill no( | 2020-12-18 18:24:02 |
| florida jhit | lo que tu digas. Cuando ya venga la Falange mirarás la pared comunista ya verás | 2020-12-17 14:35:37 |
| florida jhit | prefiero ser mamhuevo que Catalan | 2020-12-17 14:27:57 |
| ✪ Eggplant | Roja como la sangre de un rey guillotinado | 2020-12-17 14:14:44 |
| florida jhit | no se que dices cuando cataluña es parte de España y siempre va a ser. Ahora vete a quemar contenedores rojito | 2020-12-17 12:25:22 |
| florida jhit | -rep rojo indepe vente pa san miriam blasco que te reviento a hostias | 2020-12-17 04:57:49 |
| ✪ Eggplant | +rep Huge load on chest | 2020-12-16 16:46:41 |
| Hoe^ | no se quien eres pero tampoco me parece normal que pongas el nombre de la persona que me firmo mejor dame alguna skin que no tengo nada que tu eres rico ajaja | 2020-12-16 13:14:39 |
| wip | we should nuke together | 2020-12-16 08:12:27 |
| wip | pro movement men | 2020-12-16 07:02:15 |
| wip | love of my life | 2020-12-14 19:50:23 |
| cinderelladarko | Which replacement knife should I buy? 200$ budget | 2020-12-14 15:28:24 |
| BLUSHFT | how do i rig model in blender 2.8 help | 2020-12-14 10:51:46 |
| cinderelladarko | I had to replace stuff in computer from best buy! | 2020-12-14 08:28:50 |
| cinderelladarko | Is steam lagging for anyone else with a big pe.nis? or just me | 2020-12-13 21:29:19 |
| Dog Nog | Gaming | 2020-12-12 06:13:35 |
| Drambuient | +rep good player (: | 2020-12-10 02:57:11 |
| Over | +rep oil = fly | 2020-12-08 12:26:00 |
| cinderelladarko | not only big inventory, he also has a big c.ock | 2020-12-08 11:59:46 |
| neptune | wow big man inventory | 2020-12-08 08:15:54 |
| ☁MaXxMuS☁ | ez | 2020-12-05 16:56:07 |
| Truesinger | add me | 2020-12-03 17:46:05 |
| neptune | hm | 2020-11-30 17:12:32 |
| Ljubo | buter dog | 2020-11-30 14:17:07 |
| cinderelladarko | +rep not toxic never cries, fat penis with nice veins | 2020-11-29 22:12:28 |
| 𝔼𝕩𝕥𝕜 | -rep ♥♥♥♥♥♥♥ kid crying | 2020-11-29 07:32:59 |
| Dog Nog | Uh, uhm, yes | 2020-11-29 07:24:29 |
| Dog Nog | -rep exists | 2020-11-29 07:09:49 |
| Yıkım Mimarı | -rep ırkçı orospu çocuğu | 2020-11-29 07:05:38 |
| 21 Savage | -rep, toxic player, cry always. | 2020-11-29 06:54:50 |
| cinderelladarko | ♥♥♥♥. my ♥♥♥♥ is throbbing rlly hard rn | 2020-11-23 20:44:32 |
| Geden | +rep | 2020-11-22 12:49:35 |
| Snus Enjoyer | +Rep insane skins | 2020-11-21 12:59:51 |
| DaBass | -rep trash player - pepper for ur f.a.t a.s.s | 2020-11-21 02:37:56 |
| Hampter 🙂 | xd nice p250 for way over the worth of overpay | 2020-11-18 02:37:54 |
| cinderelladarko | my ♥♥♥♥ just appears to get bigger and bigger every day :nervous_face_with_sweat: | 2020-11-17 23:04:49 |
| Piguman - 永远的神 | market is 16 usd, so you overpayed 80% stickerprice and its worst pos | 2020-11-17 15:22:41 |
| Piguman - 永远的神 | you cucked yourself with the p250, you overpayed too mcuh and got sharked | 2020-11-17 14:15:21 |
| Hoxton | thank u butter dog, appreciate ya. | 2020-11-17 08:19:38 |
| wip | Best player I've played with in my life, just needs to work on communication, aim, map awareness, crosshair placement, economy management, pistol aim, awp flicks, grenade spots, smoke spots, pop flashes, positioning, bomb plant positions, retake ability, bunny hopping, spray control and getting kills | 2020-11-15 18:03:07 |
| DaBass | iam the best. | 2020-11-14 04:03:33 |
| cinderelladarko | Friends 168133"I DESPICE BANANAS"Online100el bartoOnline85AUFOffline76NagaOnline72S T A B B YIn-GameApex Legends67Doge WoofIn-GameCounter-Strike: Global Offensive | 2020-11-12 14:15:37 |
| cinderelladarko | ★ M9 Bayonet | AutotronicCounter-Strike: Global OffensiveCounter-Strike: Global Offensive★ Covert KnifeExterior: Minimal Wear This is the M-9 bayonet. Originally intended to be mounted on a rifle, it is also well suited to close-quarters combat. It has been anodized red and uses steel mesh to lighten the weight. Inspect in Game...Tags: Knife, M9 Bayonet, ★, Covert, Minimal Wear, Tradable, Marketable | 2020-11-12 10:10:57 |
| FRANCO | eres bueno eh con 2000 horas y coges el cuchillo al reves | 2020-11-12 07:41:56 |
| Blood gang | suck uss ♥♥♥♥♥♥♥ ♥♥♥♥♥♥ -rep ♥♥♥♥♥ | 2020-11-10 06:07:54 |
| cinderelladarko | Someone told me you had a fat ♥♥♥♥ is that true | 2020-11-08 14:43:47 |
| Semko | skin? | 2020-11-07 13:22:43 |
| FaZe HAMDO TIGAR | !give skin | 2020-11-07 07:05:11 |
| FaZe HAMDO TIGAR | Jebem ti mater | 2020-11-07 07:05:01 |
| wip | do you really love pepper mate? | 2020-11-04 13:33:30 |
| wip | ai lave yu men | 2020-11-04 06:26:11 |
| Lady Noctowl | que tio | 2020-11-01 16:29:31 |
| Rocky | ty for the comment loser <3333 | 2020-11-01 13:14:44 |
| Lady Noctowl | ^^ | 2020-10-30 06:38:45 |
| Lady Noctowl | el mismo | 2020-10-30 05:55:51 |
| Lady Noctowl | ? | 2020-10-30 05:23:51 |
| Lady Noctowl | crazy chemist deja a mi familia en paz ya te pague la coca es hora de que te busques a otra persona | 2020-10-27 09:05:18 |
| Lady Noctowl | trozo demierda deja de postear fotos tuyas en steam primer aviso | 2020-10-27 01:56:17 |
| elas♱ik. | A nadie le interesa tus periféricos, primer aviso | 2020-10-25 13:59:03 |
| YACACHA | -rep no skill, no aim | 2020-10-25 05:31:09 |
| tocxjo | arab walter white???????????????????????????????????????????????????????????? | 2020-10-21 16:44:04 |
| ★Ɠè†ɏиĩṣ★ | +rep nice red themed inventory | 2020-10-17 07:14:56 |
| barbosa | omg hahaha | 2020-10-14 14:03:26 |
| Haze | +rep. really retarded :=) | 2020-10-12 08:25:23 |
| barbosa | nice scam | 2020-09-23 16:23:14 |
| Lady Noctowl | this song goes very hardlove from kazakhstan 🇰🇿i hate women so much its unreal | 2020-09-16 15:03:54 |
| JodecamperosGZ | todo el mundo haciendo el baile del dineroooo | 2020-09-15 20:06:41 |
| ✶Lucky Sh0t✶ | -rep дayн который купил скины а скила 0 | 2020-09-15 11:00:44 |
| tocxjo | basado | 2020-09-15 07:04:13 |
| ghostface | эй я твою маму Ёбал | 2020-09-06 13:32:44 |
| NoHitBox | Lo mismo se podría decir de tu exposición de artículos del CSGO, tóxico. | 2020-09-05 15:47:42 |
| elas♱ik. | Jode no poder presumir de cara eh | 2020-09-05 11:17:02 |
| ✪ Kukas | Bro quien coño eres y porque estoy en tu bio | 2020-08-29 20:15:56 |
| Lady Noctowl | ME VOY A TIRAR A TU MADRE)) | 2020-08-28 09:17:28 |
| Dosia_Cuteboy | better buy aimbot than skins bro :) | 2020-08-21 17:43:38 |
| antonio1978 | Vaya payaso que eres | 2020-08-20 09:27:13 |
| L. | Hey man I played with you recently and so basically im monki | 2020-08-18 13:07:31 |
| Bini | why you bullying me...... its just a game...nice inv btw <3 | 2020-08-17 11:29:15 |
| St4yFr0sty | epic csgo player. Yo hablar poco de espanol pero me espanol es mierda | 2020-08-14 11:45:59 |
| Jonde | Something about commenting 3 years later to a post | 2020-08-14 06:54:24 |
| Jonde | imagine someone seeing your comment on a gta post from 4 months ago and commenting on your profile. | 2020-08-13 19:21:04 |
| KxNxC CEO | who the hell are you | 2020-08-13 13:01:13 |
| Everything Will Be Alright | + pro faceit nice red set add me | 2020-08-12 11:51:49 |
| твои мертвые | Tus muertos Payaso | 2020-08-11 07:17:51 |
| твои мертвые | Payaso | 2020-08-10 08:48:11 |
| antonio1978 | ME GUSTA EL BASKET Y LEER | 2020-08-10 08:03:10 |
| antonio1978 | ERES MI PUTITA | 2020-08-10 06:34:35 |
| твои мертвые | Payaso | 2020-08-10 06:34:30 |
| Lady Noctowl | lml | 2020-08-10 02:19:17 |
| Lady Noctowl | Menuda caja de comentarios más guapa | 2020-08-09 22:00:48 |
| blueee | -REP TOXIC | 2020-08-09 13:45:05 |
| твои мертвые | mucho textoPayaso | 2020-08-09 11:32:28 |
| antonio1978 | mucho texto | 2020-08-09 11:32:26 |
| antonio1978 | putita | 2020-08-09 10:52:32 |
| antonio1978 | payasito | 2020-08-09 10:52:28 |
| William Jacob | MuXa SQin PoKa ZCills | 2020-08-09 10:51:51 |
| antonio1978 | mucha skin poca SKILL | 2020-08-09 10:51:31 |
| твои мертвые | PaYaSo | 2020-08-09 10:50:39 |
| William Jacob | -rep racism | 2020-08-09 10:50:39 |
| Fer | Luego vienes a la gente a decir que si no sabe decir nada más. Tu lo único que haces es insultar porque se te acaban los argumentos sabiendo que es verdad lo que te dice la gente. Anda que un español tóxico... Si fueses un guiri lo entendería pero un español... Hay que nacer especial | 2020-08-08 17:03:27 |
| Fer | Bro, yo creo que si fueses menos tóxico no tendrias tanta mala influencia, es un consejo que te da alguien con mejor cabeza que tú. O la tomas o te jodes | 2020-08-08 16:49:58 |
| твои мертвые | Payaso | 2020-08-08 13:08:57 |
| antonio1978 | hay en vez de ahi no veas lo que hay que leer y encima no es colega mio | 2020-08-07 20:18:06 |
| antonio1978 | Te Gusta el basket payaso ? | 2020-08-07 10:51:41 |
| твои мертвые | Payaso | 2020-08-07 10:48:56 |
| твои мертвые | Puto manco | 2020-08-07 08:20:02 |
| antonio1978 | YO EN LOS TUYOS | 2020-08-07 08:18:50 |
| antonio1978 | ME CAGO EN TUS MUERTOS PAYASO | 2020-08-07 07:29:27 |
| твои мертвые | ME CAGO EN TUS MUERTOS PAYASO | 2020-08-07 07:28:44 |
| Fer | ? | 2020-08-07 07:01:29 |
| Fer | que triste | 2020-08-07 05:03:44 |
| Fer | hay esta un inmaduro, perfe | 2020-08-07 05:02:47 |
| Fer | -rep toxic | 2020-08-07 04:04:52 |
| antonio1978 | MANCO | 2020-08-06 03:04:43 |
| Lady Noctowl | Esta guapo el M9 que te has agenciado, a ver si te scamean pronto los rusos | 2020-08-05 17:37:53 |
| FeuerKing | Yu | 2020-07-30 15:27:11 |
| FeuerKing | ;c | 2020-07-30 13:59:59 |
| FeuerKing | c; | 2020-07-30 13:45:29 |
| FeuerKing | :c | 2020-07-30 12:46:13 |
| FeuerKing | accept my friend request pls | 2020-07-30 11:40:09 |
| FeuerKing | i have a question pls accept | 2020-07-30 11:23:38 |
| Beat Box | me cago en tuputa madre cabronazo | 2020-07-29 10:30:46 |
| FullextremeESP | -rep toxic | 2020-07-29 10:24:09 |
| Beat Box | tu eres tontito q quiere llamar la atencion pk no tiene amigos ajajajja i pa casa crack | 2020-07-22 11:37:25 |
| L. | -rep after a good game in Tf2, i added him because he seemed like a cool guy. We got chatting, over the next couple of months we became good friends. Lots of banter, lots of great Tf and most importantly true friendship.I invited him to my house for a Tf2 lan party. He said he was coming so i was looking forward to meeting him in real life.When he arrived at my house, he pushed me against the wall and started nibbling my ear, i felt his hard♥♥♥♥♥♥push against my leg. I punched him and then 1 tapped him. Turns out he was gay. Don't trust this guy.:ecchirin::Speech_Love: | 2020-07-20 14:50:02 |
| Beat Box | me cago en puta madre este tio es muy toxico | 2020-07-20 09:13:30 |
| L. | pee | 2020-07-18 18:24:03 |
| L. | crap and piss !!! | 2020-07-18 18:23:57 |
| L. | piss and poop | 2020-07-18 18:23:45 |
| Lady Noctowl | te gastas las paguitas del estado? | 2020-07-16 18:12:00 |
| Lady Noctowl | Tu que eso es un bot que te quiere robar la AK bloodsport que tienes | 2020-07-16 17:35:12 |
| Lady Noctowl | tablas de canada | 2020-07-15 07:13:37 |
| Svenja | who the ♥♥♥♥ aer you | 2020-07-14 19:08:51 |
| Lady Noctowl | tablas de crasy xemist barrabaja 2 | 2020-07-12 12:40:26 |
| Lady Noctowl | tablas de | 2020-07-12 07:49:54 |
| L. | perish | 2020-07-11 12:06:57 |
| Fryers | :pppppppp gimme that | 2020-07-11 02:21:34 |
| Fryers | FRIEND* | 2020-07-10 14:26:34 |
| Fryers | DONT TELL ANYTHING BAD ABOUT MY LITTLE STEP FRIENDS | 2020-07-10 14:26:26 |
| Macla | -rep by far the worst player I have ever met for his hours, and i mean by far. | 2020-07-10 07:36:09 |
| Fryers | :( | 2020-07-05 10:19:12 |
| warm milk | :) | 2020-07-04 13:41:24 |
| warm milk | -rep, toxic. | 2020-07-04 13:40:22 |
| JustTooSalty | +rep my disabled dad | 2020-07-04 10:27:40 |
| twitch.tv/jorgeasault14 | ___________________________######____________________________________######_____________________________________####_______________________________________##______________________________________######___________________________________#######___________####__________________#########__________######________________###_######__________######_______________###__######___________####_______________###___######______________##################____######______________##################+REP######______________#################____######________________###_______#####_____######_______________###_______#####______######______________###________#####______######_________#######_________##########_##############_____________________________________________ | 2020-07-02 11:37:44 |
| twitch.tv/jorgeasault14 | man en silla de ruedas +rep | 2020-07-02 11:36:30 |
| Fryers | +reperino brotherino | 2020-06-30 11:26:02 |
| treis6969 | +rep eu vou pegar seu avo pelo pau | 2020-06-30 11:05:49 |
| #BatinoOpel-TonyFodeSonyXperia | -rep toxic player | 2020-06-28 11:31:00 |
| ¿¿blandiblu?? | marico-n? :( | 2020-06-28 11:25:32 |
| Marcus | Gaming | accept my friend request | 2020-06-19 11:29:24 |
| dnsnapper | Hi, add me, I have an interesting offer and present for you | 2020-06-18 08:15:33 |
| L. | burp | 2020-06-17 11:48:31 |
| Pim de Keysergracht | ♥♥♥ Gary | 2020-06-05 16:14:59 |
| Pim de Keysergracht | ♥♥♥♥♥♥ | 2020-06-05 16:14:46 |
| M | add me for trade. | 2020-06-05 12:18:07 |
| 🔱𝓛𝓾𝓕𝓕𝔂🔱 | orosbunun ta kendisi piç kurusu ancak negev oyna piç | 2020-06-04 11:39:44 |
| Vash | disfruta de tus 7 dias de baneo comepollas jajajajjajajajajajajjajaja | 2020-05-30 20:08:14 |
| Aliex01 | Disfruta de tus 7 dias de baneo en counter | 2020-05-24 13:15:52 |
| L. | basketball pene | 2020-05-23 12:11:45 |
| Woof Woof | +rep thx for the knife | 2020-05-19 09:22:17 |
| Antoine Forqueray | SHUT UP | 2020-05-17 11:11:20 |
| Antoine Forqueray | shut up | 2020-05-16 11:23:27 |
| huhnkieleo | t qui? | 2020-05-16 11:14:29 |
| Woof Woof | +rep thx for the karambit lore | 2020-05-14 05:53:04 |
| vlone | -rep super toxic | 2020-05-12 19:58:07 |
| HORRY HORNET | die bastard | 2020-05-11 10:40:15 |
| HORRY HORNET | I'll hit you in the head when you're blinded | 2020-05-09 10:24:24 |
| HORRY HORNET | Shut up as.shole | 2020-05-09 07:50:22 |
| HORRY HORNET | Mutually noob. | 2020-05-08 07:44:49 |
| Buster | 13 years old | 2020-05-08 06:57:07 |
| Buster | nc email hahaha | 2020-05-08 06:53:45 |
| Buster | Hahaajaj dimitry2007 =13 | 2020-05-08 06:52:36 |
| Buster | Penis | 2020-05-08 06:51:47 |
| Mau Mau | litle | 2020-05-08 06:51:25 |
| Mau Mau | your | 2020-05-08 06:51:21 |
| Mau Mau | whith | 2020-05-08 06:51:18 |
| Buster | @ahahahah who are you robloxer | 2020-05-08 06:51:16 |
| Mau Mau | play | 2020-05-08 06:51:12 |
| Mau Mau | go | 2020-05-08 06:51:08 |
| Mau Mau | ahahahahaha | 2020-05-08 06:51:06 |
| alves | you trie men you trie | 2020-05-08 06:50:16 |
| Buster | Noob | 2020-05-08 06:50:04 |
| alves | ♥♥♥♥ you stupid retarded | 2020-05-08 06:49:09 |
| Buster | And do you know me? | 2020-05-08 06:47:32 |
| Buster | But why who are you do you know me? | 2020-05-08 06:46:43 |
| Buster | Tell me what you want | 2020-05-08 06:44:44 |
| Buster | Who are you? | 2020-05-08 06:42:31 |
| Vash | comeme los huevos pedazo de chupaescroto | 2020-05-07 09:10:49 |
| PERROTRUKIS | hey friend why you mad at PRO PLAYER VASHLAESTAMPIDA | 2020-05-07 09:10:29 |
| huhnkieleo | White girls ♥♥♥♥ dogsWhite girls ♥♥♥♥ dogsWhite girls ♥♥♥♥ dogsWhite girls ♥♥♥♥ dogsWhite girls ♥♥♥♥ dogsWhen they come home from the bar and they're all aloneWhite girls ♥♥♥♥ dogs and their big read bone.They don't do it cause it's good for their healthIt's just the way white girls express themselves yeah.White girls ♥♥♥♥ dogs(They ♥♥♥♥ 'em)White girls ♥♥♥♥ dogs(They really ♥♥♥♥ 'em)White girls ♥♥♥♥ dogsWhite girls ♥♥♥♥ dogsWhite girls ♥♥♥♥ dogs | 2020-05-06 15:08:48 |
| huhnkieleo | not cool bro, not cool. | 2020-05-05 17:23:42 |
| Ljubiša Preletačević Beli | -rep | 2020-05-02 11:24:53 |
| Bird | fotknit L | 2020-05-01 12:38:19 |
| Lalo🔊 GB PL RU | ak safety net FN EZ. Already sold it dont owrry | 2020-04-30 13:42:44 |
| Kamezon⎝ツ⎠ | Don't cry more virgin guy | 2020-04-24 08:51:47 |
| YeYo | minecraft player | 2020-04-17 11:46:31 |
| Eχis†enƵ | Thanks Dude xD | 2020-04-08 11:16:51 |
| Eχis†enƵ | Okay? | 2020-04-07 13:58:50 |
| driver (2011) | Just unsubscribe to the binding of isaac mod to remove it. | 2020-03-28 07:56:43 |
| -h0Mi$- | paquete no. PAQUETON. vete a jugar a las chapas bobo | 2020-03-25 16:57:57 |
| L. | +rep epic and based manmost epic man in the world | 2020-03-15 10:59:18 |
| Lady Noctowl | Er krasixemis | 2020-02-14 12:23:59 |
| Pim de Keysergracht | Hope you and your f.ucking family die in a house fire slowly and painfully | 2020-02-11 12:47:26 |
| FUNTIK (supreme leader) | your mom is dumb | 2020-01-23 05:21:51 |
| ManuGGEZ | ASPERGER | 2020-01-04 12:24:01 |
| Lil` Shredder | I believe that you die from brain cancer in your house alone , cause ur whole family is dead alredy | 2020-01-04 09:12:41 |
| Matze | Dont Cry to hard when u lose ^^ | 2019-12-21 12:29:10 |
| Exohell | bruh vibe check | 2019-12-04 13:52:46 |
| hekboi | I see you last played Quake yesterday, was it your first playthrough? Did you like it? | 2019-12-03 17:01:08 |
| Daika | thank's | 2019-11-15 06:31:33 |
| Pim de Keysergracht | R ETARD ALEERT | 2019-11-07 03:47:04 |
| RwbyDaCherry | save the world,my final message, good bye | 2019-10-19 11:59:34 |
| Violence... Always a way out. | привет я димитрий люблю баскетбол и ем задницу))))))) | 2019-10-02 05:43:16 |
| Violence... Always a way out. | Г О В Н О | 2019-10-02 05:42:57 |
| Violence... Always a way out. | Жри говно и не открывай ёбло своё, дмитрий ♥♥♥♥♥♥♥♥♥♥ | 2019-10-02 05:42:44 |
| SilencedDemolisher | xd | 2019-09-28 13:23:56 |
| SilencedDemolisher | btw i can lift your whole ♥♥♥♥♥♥♥ house you little no food braindead ♥♥♥♥ can you even pay for school? oh wait it's for free in your country | 2019-09-26 14:07:49 |
| SilencedDemolisher | says you hidded weeb stfu you watch anie and you are arabic that iboth bad and sab i bet you live in a ♥♥♥♥♥♥ city with cancer and trash wifi and you are too naive to know the difference between a anime fan and a weeb ♥♥♥♥♥♥ cant even understand a simple word ♥♥♥♥♥♥♥ moron | 2019-09-26 14:06:10 |
| SilencedDemolisher | you cant use your hands or what?you handicapneeds advantage to win in a fight what a loser i guess that is what csgo makes you YIKES | 2019-09-26 11:11:20 |
| SilencedDemolisher | say that to allah he will terminate you | 2019-09-25 12:50:05 |
| SilencedDemolisher | nice cancerous name i bet it means im stupid and i am disabled | 2019-09-22 04:39:13 |
| SilencedDemolisher | stfu you fat ♥♥♥♥♥♥♥ ♥♥♥♥ hope you die because you have nobody and nobody will love you <3 | 2019-09-21 14:08:54 |
| SilencedDemolisher | good one moron are you high right now or when are you going to do it? just kill yourself no one cares about you | 2019-09-21 09:06:10 |
| SilencedDemolisher | right? you can't even type my dude are you ♥♥♥♥♥♥♥ high? | 2019-09-20 10:15:40 |
| SilencedDemolisher | says you ♥♥♥♥♥♥ look at your own ♥♥♥♥♥♥♥ profile handicapped little moro.n | 2019-09-20 10:15:19 |
| SilencedDemolisher | good one weeb look at your own favorite group weeb. | 2019-09-19 05:54:04 |
| milf | +rep sexy butt | 2019-09-19 05:10:25 |
| SuperCrazySanTV CSGORUN | Долбаёб детектед | 2019-09-19 05:10:12 |
| ghostface | Да ты pebik | 2019-09-19 03:02:19 |
| SilencedDemolisher | i just like anime i dont live out of it to be called a weeb ♥♥♥♥♥♥ brainless trash player | 2019-09-17 12:29:53 |
| SilencedDemolisher | -rep toxic | 2019-09-17 10:47:46 |
| SVG | -rep nooob sucks a huge ♥♥♥♥ in this game | 2019-09-17 09:51:49 |
| Houbáč ČtvercoKalhotník | who is Vojitas | 2019-09-16 16:27:58 |
| Dunkek | you are my brother :( | 2019-09-16 16:27:47 |
| Houbáč ČtvercoKalhotník | bad human | 2019-09-16 16:26:28 |
| Dunkek | you are bad as your mom in my bed :( | 2019-09-16 16:25:41 |
| Violence... Always a way out. | youre nervous | 2019-09-16 02:58:10 |
| Violence... Always a way out. | Wtf dude? How can I help u? | 2019-09-16 02:57:56 |
| Violence... Always a way out. | Обоснуй | 2019-09-15 10:26:51 |
| zNightmxre | ? | 2019-09-07 09:43:00 |
| Pilk Drinker | This man is super hot, send him all of your nudes <3 | 2019-09-07 07:59:29 |
| SAVVIDIS | ur dad has a lesbian sister | 2019-09-07 01:38:52 |
| Makaveli | call the cops | 2019-08-27 06:02:49 |
| Makaveli | i delete bro | 2019-08-27 06:02:33 |
| Makaveli | ahahahhaah | 2019-08-27 06:01:52 |
| Makaveli | you now i can delete your comment in my profile | 2019-08-27 05:16:30 |
| -rep brainless woman | Haha, one more nonsense comment on my wall and i'm gonna block you babe ;* | 2019-08-21 03:09:50 |
| alt + f4 to receive a prize!!! | Toxic ♥♥♥♥ | 2019-08-09 07:49:07 |
| -rep brainless woman | -rep Please wash your mouth, may god bless you. (I'm not ,,him" So stfu.) | 2019-08-08 14:02:34 |
| 𝙣 𝙚 𝙠 𝙞 𝙖 𝙣 | -rep I hope his whole family burn in a car or something | 2019-08-07 16:43:56 |
| Magic Promo | Big August Giveaway on the best CS:GO magic upgrade Join and get your AWP | Asiimov for ♥♥♥♥♥♥♥♥♥♥♥magic .com | 2019-08-07 01:49:12 |
| YungHera | -rep | 2019-08-06 13:33:49 |
| BEST LOTTERY | Dear winnerYour SteamID is selected as winner of Weekly giveaway.Get your ★ Butterfly Knife | Doppler Phase 2 on skins-boost.com Use personal code: YR56ikLMv5u7 | 2019-08-04 15:04:52 |
| Snuff | cs go noob minecraft pro player | 2019-06-07 11:45:19 |
| Snuff | bot | 2019-06-07 11:44:50 |
| dio | who the ♥♥♥♥ are u fat girl? | 2019-06-05 17:52:33 |
| TrotskySuperStar | deberías dedicarte a cómico, la gente se reirá de ti y no contigo de la hostia | 2019-06-04 05:59:50 |
| TrotskySuperStar | tu sigue llorando e insultando a los demás que no sirves para nada mas desgraciado | 2019-06-02 23:54:01 |
| TrotskySuperStar | PARA DECIRLE A TU MADRE QUE LOS VIDEOJUEGOS TE SIENTAN MAL EN LA CABEZA CERNIIIIIIIIIIIIIICALO | 2019-06-01 06:57:26 |
| Graxwell | who pissed in your salad m8 why the flame | 2019-05-31 20:05:28 |
| TrotskySuperStar | cuantos años tienes? | 2019-05-31 17:51:46 |
| Emperor Palpaclean | Service was great, kids loved the savers menu and the staff were very friendly. 5 Stars would definitely eat here again. | 2019-05-31 17:16:16 |
| TrotskySuperStar | un cernícalo más en este mundo | 2019-05-30 18:52:45 |
| TrotskySuperStar | pero como eres tan mierda si se puede saber? | 2019-05-30 04:31:36 |
| 76561198225402552 | Hey bro, there is promoaction from CSMONEY! Take your 50$-250$(the amount depends on hours in csgo) to our users with promocode! Promo limited , do not miss your chance to take ♥♥♥♥♥♥♥♥♥♥! Link to csmoney at my profile | 2019-04-25 06:33:49 |
| Natacha | really useful post https://www.reddit.com/search?q=title:ACTIVE_Giveaway_from_asian_guy_for_7000$+selftext:аnу&show=1 | 2019-04-22 00:01:22 |
| BEST LOTTERY | Dear winnerYour SteamID is selected as winner of Weekly giveaway.Get your ★ Butterfly Knife | Doppler Phase 2 on high-skins.com Use personal code: YR56ikLMv5u7 | 2019-04-19 11:02:35 |
| APM(Reformado) | +rep good friend thx bro ! | 2019-03-29 09:12:58 |
| SVH | Cheater! | 2019-03-08 12:50:58 |
| PuMuKy | Signed by PuMuKyツ | 2019-03-08 12:41:23 |
| Marbu | payaso | 2019-03-03 13:34:08 |
| Javari_Derp | Menudo tilteado que eres | 2019-03-03 11:26:58 |
| CuteLizard | Im so close to say the n word º-º AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA PLIS GOD STOP ME FROM DOING ITTTTTTTTN N N NNUGGETS! | 2019-02-16 16:28:12 |
| Orange | +rep dont have to be mad its only game | 2019-02-08 17:27:54 |
| Paul Kellerman | Orospu çocuğu | 2019-02-05 05:23:26 |
| saino | damn that you make penny kid to insult because you do not like a thing serieu how old to make his 8 years? if your more than 20 serious question your fear of even gen as apert me I am jerking your con you will remain but please respect the pasion of others as we respect your pasion to you ^^ so grown up one can ok me I'm not an ♥♥♥♥♥♥♥ to insult it for free on this I die you more | 2019-01-27 17:27:53 |
| NOOBS | sorry im pro | 2019-01-26 17:13:56 |
| TESTOTOMI #Trenboloni Gang | you‘re gay | 2019-01-23 12:02:51 |
| TESTOTOMI #Trenboloni Gang | your mother has AIDS | 2019-01-22 03:34:40 |
| ♛ᴿᴼᵞᴬᴸCedry2k | Du-te drq de tigan prost cu comenurile tale pe profile =] | 2019-01-19 06:04:52 |
| ♛ᴿᴼᵞᴬᴸCedry2k | -rep | 2019-01-15 07:48:57 |
| KrEmLiNn\$$$Cortex$$$/ | Lol dimitry2007. Why you went coment on my profile? Noob. Just got rekt inG... u will never learn.. | 2019-01-03 22:53:24 |
| Dastiche | -rep nevermind he is a younglad dont bully him, he gets mad easily | 2018-12-28 13:31:59 |
| Dastiche | -rep so bad, so toxic, | 2018-12-28 13:26:01 |
| TESTOTOMI #Trenboloni Gang | angry russian gay | 2018-12-21 12:50:43 |
| TESTOTOMI #Trenboloni Gang | who even are you, you russian ♥♥♥? xD | 2018-12-21 07:54:20 |
| Shlifer | stupid russian blyat | 2018-12-07 06:45:52 |
| Arthropleura | +rep I feast on ♥♥♥ | 2018-12-02 13:51:29 |
| Whitenova | Nice NAme | 2018-12-01 11:29:12 |
| MitWodka420 | ouhhh realy toxic player | 2018-11-25 10:41:16 |
| Whitenova | Lovely boy | 2018-11-25 07:53:56 |
| MitWodka420 | Toxic | 2018-11-25 04:48:09 |
| paranoid | <3 why you drop the pistol? | 2018-11-17 12:14:37 |
| Rodas | Hola por que me has llamado gilipollas no se quien eres saludos!! | 2018-11-17 05:00:42 |
| 76561198053501090 | ok | 2018-11-16 17:32:40 |
| Nycae | uwu | 2018-11-16 17:24:50 |
| 76561198053501090 | :steamsal | 2018-11-16 17:24:27 |
| Hypersir | UwU mancazo | 2018-11-16 17:24:09 |
| 76561198053501090 | UwU so noob | 2018-11-16 17:23:29 |
| xxampi | UwU | 2018-11-16 17:23:04 |
| paul | -rep worst noob ever ahahaha so noob at the game | 2018-11-15 15:17:16 |
| 76561198172708475 | ♥♥♥♥♥♥♥ NOOB! | 2018-11-15 12:01:03 |
| Duchhh | DU BIST EIN KLEINE FICHTEL | 2018-11-14 10:00:00 |
| Druckur | llora nena llora | 2018-11-04 13:27:58 |
| D3C☢Y♿ | que te pasa noob para ir escribiendo comentarios el perfiles niño rata | 2018-11-04 10:13:03 |
| COCOOOOOOOOOO | inferior | 2018-11-02 16:36:15 |
| Egg | you are 9 years old you monkey | 2018-11-02 08:27:08 |
| Egg | how am i a normie? youre literally a underage spastic child with mental issues | 2018-11-02 07:24:22 |
| Egg | shut up autistic degenerate childish virgin | 2018-11-02 04:51:56 |
| Egg | why did you comment cuss words on my profile | 2018-11-02 04:17:02 |
| Egg | more like fortnite island | 2018-11-02 04:15:12 |
| Egg | virgin islands | 2018-11-02 03:45:35 |
| MIIM | +rep, very sex boy | 2018-10-27 12:08:03 |
| The OG | cry some more ♥♥♥♥♥ boo hoo | 2018-10-21 15:15:23 |
| The OG | lol stop crying i literally dont know you | 2018-10-21 12:15:30 |
| The OG | i dont even remember you ngl | 2018-10-21 11:50:08 |
| The OG | lmao why you come back like 2 weeks later to comment im bad | 2018-10-21 11:49:58 |
| vintern | go man | 2018-10-20 20:49:02 |
| doctwoeight | 100% Mentally challenged Best CS:GO teammate i ever hadSigned by Doc | 2018-10-20 18:37:28 |
| doctwoeight | 100% Retarded autistic man Best CS:GO teammate i ever hadSigned by Doc | 2018-10-20 18:30:24 |
| 𝕃𝕆𝔹𝕆 | venga hombre yo tambien te quiero. | 2018-10-13 19:53:25 |
| Koyaha | jeb się kurwo | 2018-10-06 12:00:21 |
| The OG | RUSSIAN C UNT GETS ME 7 DAY BAN CAUSE HE TROLLS LIKE A PIECE OF SH!T | 2018-10-06 11:28:40 |
| The OG | -rep russians are all cancer die | 2018-10-06 11:25:50 |
| The OG | -rep Piece of ♥♥♥♥ | 2018-10-06 11:15:05 |
| aLVaRoZz01 | Menudo gilipollas que estás hecho, encima vienes a comentar a mi perfl, es que no tienes otra cosa mejor que hacer. Cuando seas bueno a algo ya hablamos. Adios noob | 2018-10-03 12:12:30 |
| LordShadowBluRay | Could you please flame this person. https://steamcommunity.com/id/striketunia He is a stupid hacker. | 2018-09-01 16:26:34 |
| Pine | No se puede ser más tonto en menos tiempo eh | 2018-08-28 09:38:58 |
| Dobha | si no te importa una mierda mi vida porque contestas cada mensaje que te envio | 2018-08-25 13:09:20 |
| Dobha | enserio esta es tu mejor contestacion | 2018-08-25 13:06:45 |
| CORSA1R | your dad is a terroist not muslims f***ing racist | 2018-08-25 12:09:26 |
| Dobha | que mal perder tienes | 2018-08-25 11:52:46 |
| RedSkittleFox | Hahaha 14yo kid xd | 2018-08-25 09:24:37 |
| dofhll | ♥♥♥♥♥♥♥ | 2018-08-24 14:51:34 |
| RedSkittleFox | I'm gonna report you for being offensive. | 2018-08-24 02:18:38 |
| Shlifer | i love basket bell too | 2018-08-23 14:57:40 |
| ♥ Hel ♥ | te amo | 2018-08-12 12:16:17 |
| OvoyB | ♥♥♥♥♥ ♥♥♥♥♥♥ | 2018-08-08 22:09:15 |
| ja man | cyka | 2018-08-07 04:07:11 |
| Whitenova | +rep best mate | 2018-08-05 09:38:52 |
| OvoyB | i'm not a smurf little boy just better than u with ur 1000 hours | 2018-08-05 08:58:52 |
| OvoyB | i love basket bell and csgo game xD so lovely | 2018-08-04 17:05:28 |
| FakeTaxi | drift | | -rep retarded | 2018-08-04 17:04:12 |
| OvoyB | so i slap ur ass and u cry | 2018-08-04 17:03:12 |
| Bligi kocur | ♥♥♥♥ you on mother | 2018-08-03 15:02:07 |
| baris | Hey you "♥♥♥♥♥♥" go ♥♥♥♥ yourself | 2018-08-03 12:07:43 |
| ★{ImMoRtAL★oF★GrEeCe}★ | i come in your home now and i ♥♥♥♥ you ♥♥♥♥♥ dog of ♥♥♥♥♥ I PLAY BASKET BALL WITH YOUR MOTHER ASS AND NEXR I I CAT YOUR FACE HEAD AND I ♥♥♥♥♥♥ | 2018-08-03 03:17:47 |
| †{ImMoRtAL†oF†GrEeCe}† | Cancer in your mother face and in am your pidor famimy bastard russia cyka i come to kill you and next to ♥♥♥♥ you all you family and you ass | 2018-08-03 03:12:56 |
| Marci | -rep idiot | 2018-08-02 14:13:12 |
| amador rivas gaming | mi novio | 2018-08-02 11:11:59 |
| †{ImMoRtAL†oF†GrEeCe}† | @@>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>> | 2018-07-25 03:56:52 |
| †{ImMoRtAL†oF†GrEeCe}† | cancer AND GO DIE WITH EMPOLAAAAAAAAAAAA BASTARD DOG OF WHOREEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE | 2018-07-25 03:56:41 |
| ★{ImMoRtAL★oF★GrEeCe}★ | CANCER IN YOUR MOTHER BASTARD DOG OF ♥♥♥♥♥ | 2018-07-24 17:52:43 |
| Outlook | -REP ♥♥♥♥♥♥♥ NOOB AND IDIOT | 2018-07-24 12:06:27 |
| †{ImMoRtAL†oF†GrEeCe}† | dog noob ♥♥♥♥♥ kid suck me ♥♥♥♥ like pro go die with cancer and killyour self its the time dog of gay | 2018-07-24 02:21:53 |
| IceBee cs.money CSGO500 | do you know muffin man? | 2018-07-22 11:15:10 |
| balapan | -rep | 2018-07-18 11:12:12 |
| ? | HA, I crossed the border! | 2018-07-17 11:15:57 |
| COCOOOOOOOOOO | que te pasa a vos pobre | 2018-07-14 22:03:31 |
| Annet | Do you want to get skins? Watch this video and enjoy 100$ GIVEAWAY - https://www.youtube.com/watch?v=sBiSfRa2OOU | 2018-07-08 06:33:18 |
| MightyVlad | Wha, wha, wha, Why hate? Dont hate! Dont worry! Be ♥♥♥♥♥♥! -Dmitri Petrenkov | 2018-06-29 16:01:13 |
| ☯︎ PauMAVA ◕︎ ‿︎ ◕ | SHUT UP ♥♥♥♥♥ BAKLAVA YU'RE MOM GAY | 2018-06-29 10:31:51 |
| Over | Thank you my Man | 2018-06-21 13:45:28 |
| $-_-ALEX-_-$(G) | go ♥♥♥♥♥♥♥♥♥♥♥♥ ♥♥♥♥♥♥ russkie kid 14 years old :D | 2018-06-18 14:12:18 |
| $-_-ALEX-_-$(G) | ez pz noob kire mohmmad to cheshay russit XDDD | 2018-06-17 08:21:18 |
| ƎЯFѦN | با من انگلیسی صحبت نکن که جوابتو با کلمات فارسی میدمجوابی که اشک از چشمای صاحب این اکانت بریزه | 2018-06-16 20:38:42 |
| $-_-ALEX-_-$(G) | Cyka mtf i hate you noob suck my ♥♥♥♥ bich ♥♥♥♥♥ | 2018-06-16 13:19:25 |
| ƎЯFѦN | cyka | 2018-06-16 10:34:09 |
| ƎЯFѦN | ты даже мой пенис | 2018-06-16 10:33:44 |
| ♚♛Skidrow™☣ | Local Disk (C:)R&W✅No Skill Found | 2018-06-15 13:26:09 |
| dimamatik | what the guide you have trouble? go chat | 2018-06-15 11:38:39 |
| suki pidorasov ubivayut | i love suck your ♥♥♥♥ my daddy | 2018-06-15 10:50:06 |
| Ricardo Milos | U hate the game cuz u cant play it xdd ? | 2018-06-15 06:43:08 |
| FrostyFeet | who are you? | 2018-06-13 16:51:42 |
| Mulle | Oh you mad | 2018-06-13 08:35:35 |
| Mulle | "♥♥♥♥♥♥♥ this and ♥♥♥♥♥♥♥ that all i know is that ur ♥♥♥♥♥♥♥ trash" | 2018-06-12 12:51:02 |
| Mulle | Git gud scrub | 2018-06-12 12:45:32 |
| Kaptenkrok | git gud ♥♥♥♥♥♥ | 2018-06-12 12:45:24 |
| ☯︎ PauMAVA ◕︎ ‿︎ ◕ | ♥♥♥♥♥♥♥ GILIPOLLAS | 2018-06-10 08:28:59 |
| Mirage_z | -rep retrasado inmenso, da pena y todo el niño! | 2018-06-03 20:37:53 |
| Haydinho | You mad bro ? | 2018-05-20 01:55:24 |
| 🤍 | -rep retrasado inmenso, da pena y todo el niño!! | 2018-05-14 06:17:30 |
| Sayonara | -Rep "OROSPU ÇOCUĞU." | 2018-05-13 15:48:10 |
| Wadda ۞ | ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ ♥♥♥♥ YOU ♥♥♥♥♥♥ | 2018-05-05 04:26:14 |
| Wadda ۞ | _ _` ᴥ |? Boi 👋 o ´ | 2018-05-03 14:19:03 |
| Antoine Forqueray | ok | 2018-04-22 12:59:15 |
| Shadow Hunter [ESP | Siento pena por ti | 2018-04-14 09:01:58 |
| THE AIM IS LOCKED | where is your MOM?!! | 2018-04-09 06:32:26 |
| El_SnIfAs | no te pongas tensa | 2018-04-03 08:48:59 |
| me | +rep | 2018-03-30 06:17:04 |
| Doramio | TUS MUERTOS PISOTEAOS EN MIERDA MARICON ME CAGO EN TU PUTA MADRE | 2018-03-27 15:14:41 |
| Robroma Klin | melon | 2018-03-14 13:41:11 |
| Velasco | anda manco que eres muy muy malo | 2018-03-09 11:43:15 |
| kevinbolero96 | Me cago en tus muertos tu puta raza si te cojo te espatarro subnormal maricona de mierda | 2018-03-08 12:19:56 |
| t1 | hui sasi | 2018-03-06 14:16:02 |
| Prepu | Qué quieres que te reviente la puta boca o qué, zoquete | 2018-02-28 17:25:44 |
| Prepu | Eres un puto subnormal, payaso | 2018-02-27 16:04:31 |
| [R]naukape | Visca catalunya lliure | 2018-02-27 12:01:06 |
| Over | Luv <3 | 2018-02-22 02:42:45 |
| Astro serioso | -rep poser bad meit lol | 2017-10-24 11:52:14 |
| kacperek czitach | -Rep ♥♥♥♥♥♥♥ idiot | 2017-10-20 14:01:05 |
| kacperek czitach | Küss meinen Arsch! | 2017-10-20 13:59:51 |
| kacperek czitach | -rep twoja stara | 2017-10-12 02:21:02 |
| lofiflyhigh | +rep nice feeder xD | 2017-09-26 08:37:37 |
| bread | do i know u? | 2017-08-29 12:42:13 |
| We0Lin | -rep ♥♥♥♥♥♥♥ noob | 2017-08-28 06:09:05 |
| Mongol thunderpick.com | you kid, and idiot | 2017-08-24 05:59:07 |
| Mongol thunderpick.com | It's time for you already to school child | 2017-08-24 01:48:13 |
| Mongol thunderpick.com | Who are you ♥♥♥♥♥♥♥ at all? It is clear that the son of a ♥♥♥♥♥ ... | 2017-08-24 01:41:08 |
| Mongol thunderpick.com | Delet your YouTube, idiot... | 2017-08-23 13:46:55 |
| Mongol thunderpick.com | Autist? | 2017-08-23 08:10:08 |
| Rondoon22 | No tienes vida no? | 2017-08-19 09:50:04 |
| Snarbou | stop comment my profil | 2017-08-13 12:45:22 |
| Snarbou | trolleur report him | 2017-08-09 10:25:33 |
| mUe | humorus persen! | 2017-08-04 13:19:16 |
| Phoenix | easy enemy :D | 2017-08-01 10:53:48 |
| Aha-Yu$ | As* okay i cant English | 2017-07-04 14:55:01 |
| Aha-Yu$ | Someone has sexy as you cannot leave | 2017-07-04 14:54:43 |
| Lecs | +REP legit and friendly trader! And also... smooth as friggin bacon... really. REALLY. | 2017-07-04 13:57:36 |
| Aha-Yu$ | Please dont i want you alive | 2017-07-04 03:37:52 |
| flan | te amo | 2017-06-01 12:50:05 |
| justJess | Never ever VAC AND YOU KNOW !!!! | 2017-05-29 15:32:26 |
| Katanx | No i dont mean simulation i mean stimulation cause i wanna be different | 2017-02-19 08:11:17 |
| Geoff | ######_____________________________________####_______________________________________##______________________________________######___________________________________#######___________####__________________#########__________######________________###_######__________######_______________###__######___________####_______________###___######______________##################____######______________##################+rep#######______________#################____######________________###_______#####_____######_______________###_______#####______######______________###________#####______######_________#######_________##########_##############__ | 2016-12-25 08:46:05 |
| opta | crazy te q | 2016-08-12 20:24:12 |
| MrMale_G | mas autista y naces | 2015-12-15 12:45:39 |
| Friend | FriendDate | UnfriendDate |
|---|---|---|
 taron | 2024-05-22 04:58:57 (37 days) | N/A |
 Jay Zeke | 2024-05-19 12:11:05 (40 days) | N/A |
 disa | 2024-05-13 20:00:25 (46 days) | N/A |
 76561199177030604 | 2024-05-13 17:36:34 (46 days) | N/A |
| 76561198351924185 | 2024-05-11 21:04:55 (48 days) | N/A |
| 76561199555518194 | 2024-05-04 15:51:06 (55 days) | N/A |
 YYanin | 2024-04-08 11:12:21 (81 days) | N/A |
| 76561199217809601 | 2024-04-02 17:42:21 (87 days) | N/A |
 unc[Sourcebans MARK] | 2024-04-01 12:21:57 (88 days) | 2024-04-30 04:41:33 (59 days) |
| 76561198452832065 | 2024-03-08 17:39:36 (112 days) | N/A |
| 76561199493440296 | 2024-03-05 04:40:31 (115 days) | 2024-04-06 07:33:24 (83 days) |
| 76561199253565460 | 2024-03-05 04:40:30 (115 days) | 2024-04-06 07:33:24 (83 days) |
 ✯ Hikari 光 <3 ✯III✯ | 2024-02-17 16:07:57 (132 days) | N/A |
 IntoSpace7 | 2024-01-25 21:29:29 (155 days) | 2024-04-06 07:33:24 (83 days) |
 limaspeek | 2024-01-25 17:05:41 (155 days) | N/A |
 Furie | 2024-01-25 14:59:02 (155 days) | N/A |
| 76561199207945163 | 2024-01-25 14:41:30 (155 days) | N/A |
 ΝΞ✖† | 2024-01-23 21:22:58 (157 days) | N/A |
| 76561199047759169 | 2024-01-23 07:51:20 (157 days) | N/A |
| 76561199385331213 | 2024-01-18 16:32:26 (162 days) | 2024-04-06 07:33:24 (83 days) |
| 76561199416253746 | 2024-01-18 16:32:08 (162 days) | 2024-04-06 07:33:24 (83 days) |
| 76561199546826543 | 2024-01-16 13:01:22 (164 days) | 2024-04-06 07:33:24 (83 days) |
 Ralf BockwurstHEBEL | 2024-01-14 13:31:21 (166 days) | 2024-04-06 07:33:24 (83 days) |
 34 | 2024-01-13 16:10:22 (167 days) | N/A |
 zokh (UNBANNABLE) | 2024-01-12 10:00:27 (168 days) | N/A |
 Maze | 2024-01-03 16:25:15 (177 days) | N/A |
 💗Nana💗 | 2023-12-28 16:01:05 (183 days) | N/A |
| 76561198980757170 | 2023-12-26 16:40:48 (185 days) | N/A |
| 76561199146382396 | 2023-12-18 04:32:16 (193 days) | 2024-04-06 07:33:24 (83 days) |
 Taydolf Swiftler | 2023-12-15 09:25:56 (196 days) | N/A |
| 76561199447892392 | 2023-12-11 18:22:20 (200 days) | 2024-04-06 07:33:24 (83 days) |
 Elsie Bush | 2023-12-02 05:09:48 (209 days) | 2024-04-06 07:33:24 (83 days) |
| 76561199152334638 | 2023-12-01 18:38:34 (210 days) | N/A |
 The 'Tronium | 2023-11-18 18:40:31 (223 days) | N/A |
 spider[Sourcebans MARK] | 2023-11-17 16:07:32 (224 days) | 2024-04-06 07:33:24 (83 days) |
| 76561199020073224 | 2023-11-17 10:28:10 (224 days) | N/A |
 obsessed | 2023-11-09 06:01:39 (232 days) | N/A |
| 76561199404598186 | 2023-10-28 15:36:15 (244 days) | 2024-04-06 07:33:24 (83 days) |
| 76561198257766881 | 2023-10-26 19:23:05 (246 days) | N/A |
 oloof | 2023-10-24 04:14:12 (248 days) | 2024-04-06 07:33:24 (83 days) |
 pokercito739 | 2023-10-22 15:46:23 (250 days) | N/A |
 who is palu? | 2023-10-20 18:38:02 (252 days) | N/A |
 heyWaffle[Sourcebans MARK] | 2023-10-17 19:54:20 (255 days) | 2024-04-06 07:33:24 (83 days) |
 baba D | 2023-10-17 19:53:35 (255 days) | N/A |
 Fryers | 2023-10-08 18:27:52 (264 days) | 2024-04-06 07:33:24 (83 days) |
| 76561198357401382 | 2023-09-29 15:03:23 (273 days) | N/A |
| 76561199487494619 | 2023-09-16 16:14:30 (286 days) | 2024-04-06 07:33:24 (83 days) |
 Shadowwood | 2023-09-13 13:57:36 (289 days) | 2024-04-06 07:33:24 (83 days) |
 nori | 2023-09-13 13:53:07 (289 days) | N/A |
 oloof[Sourcebans MARK] | 2023-08-11 02:51:32 (322 days) | N/A |
| 76561199402940015 | 2023-08-10 11:09:37 (323 days) | N/A |
 +w King | 2023-07-28 21:14:27 (336 days) | N/A |
 ｌｅｙｙｙｋａ𓆩♥𓆪 | 2023-07-24 02:51:05 (340 days) | N/A |
 kfest | 2023-07-22 19:34:20 (342 days) | 2024-04-16 13:11:47 (73 days) |
 ljubo | 2023-07-19 08:16:51 (345 days) | N/A |
 herionn- | 2023-07-19 01:58:11 (345 days) | N/A |
| 76561199479078177 | 2023-07-18 11:55:38 (346 days) | N/A |
 Norhton Rose Fullbright | 2023-07-08 18:42:24 (356 days) | N/A |
 K' lo√er*** | 2023-07-05 14:35:17 (359 days) | N/A |
| 76561198215049988 | 2023-06-14 19:38:37 (380 days) | N/A |
| 76561197999735783 | 2023-06-12 07:16:56 (382 days) | N/A |
 MadnessOfMany | 2023-06-04 18:03:28 (390 days) | N/A |
| 76561199510749783 | 2023-06-04 13:55:25 (390 days) | N/A |
 gezu | 2023-05-27 19:00:00 (398 days) | N/A |
| 76561198811507887 | 2023-05-26 06:42:51 (399 days) | N/A |
 Supersonic Saint | 2023-05-22 16:38:56 (403 days) | N/A |
 pacmac | 2023-05-19 07:31:52 (406 days) | N/A |
 Konork | 2023-05-10 15:09:20 (415 days) | N/A |
| 76561198991496005 | 2023-05-10 14:42:57 (415 days) | N/A |
| 76561199497495951 | 2023-05-04 05:11:01 (421 days) | N/A |
| 76561199379486364 | 2023-04-26 01:21:20 (429 days) | N/A |
| 76561198063930956 | 2023-04-25 14:59:51 (430 days) | N/A |
 Bill_Kevin | 2023-04-20 14:44:46 (435 days) | N/A |
 mn3 | 2023-04-16 01:11:04 (439 days) | N/A |
 NIGHTWERE | 2023-04-10 10:24:10 (445 days) | N/A |
| 76561199369274036 | 2023-04-08 04:58:58 (447 days) | N/A |
| 76561198265865110 | 2023-04-07 14:19:53 (448 days) | 2024-04-06 07:33:24 (83 days) |
 anarkezzO^ | 2023-03-28 05:41:36 (458 days) | N/A |
 Kylar | 2023-03-27 17:47:16 (459 days) | N/A |
 登记的性犯罪者 | 2023-03-05 17:57:48 (481 days) | N/A |
 no emotions | 2023-03-05 05:16:38 (481 days) | N/A |
| 76561199480106725 | 2023-02-20 11:46:05 (494 days) | N/A |
| 76561199163526743 | 2023-02-18 19:33:18 (496 days) | N/A |
 naru | 2023-02-14 18:30:02 (500 days) | N/A |
| 76561199023603682 | 2023-02-09 18:06:29 (505 days) | N/A |
 walter hartwell fart | 2023-02-04 09:51:32 (510 days) | N/A |
 Polar | 2023-02-03 20:46:55 (511 days) | N/A |
| 76561199016391890 | 2023-02-03 12:07:03 (511 days) | N/A |
| 76561198030842460 | 2023-02-02 05:13:23 (512 days) | N/A |
| 76561198061907053 | 2023-01-19 11:14:21 (526 days) | N/A |
 lontra | 2023-01-10 13:05:04 (535 days) | N/A |
| 76561198411934767 | 2023-01-09 05:45:50 (536 days) | N/A |
 emi | 2023-01-05 13:39:46 (540 days) | N/A |
 王八蛋 | 2023-01-04 09:32:40 (541 days) | N/A |
 reno | 2023-01-03 13:19:02 (542 days) | N/A |
 WYBIX | 2022-12-29 13:20:39 (547 days) | N/A |
| 76561198129539658 | 2022-12-05 20:19:54 (571 days) | N/A |
| 76561198365748419 | 2022-11-14 15:03:00 (592 days) | N/A |
 briiibaby | 2022-11-04 06:30:45 (602 days) | N/A |
 Frisout | 2022-11-03 05:27:33 (603 days) | N/A |
 -.washed | 2022-11-01 14:40:16 (605 days) | 2024-04-06 07:33:24 (83 days) |
 Macho | 2022-11-01 14:19:28 (605 days) | N/A |
| 76561199380739160 | 2022-09-25 05:17:05 (642 days) | N/A |
| 76561198376246491 | 2022-09-11 03:50:25 (656 days) | N/A |
 wHY-sKY | 2022-09-08 17:13:14 (659 days) | N/A |
 diamondminer34 | 2022-09-05 12:26:43 (662 days) | N/A |
 *PrEdAtOr*ESP*No SoUnD* | 2022-09-04 05:19:37 (663 days) | N/A |
 GelixCSGO | 2022-08-31 01:26:35 (667 days) | N/A |
 moonfighter | 2022-08-30 09:50:25 (668 days) | N/A |
 Solnceva | 2022-08-28 05:24:07 (670 days) | N/A |
 ✪ Cheslavgusev | 2022-08-26 21:36:46 (672 days) | N/A |
| 76561199118860576 | 2022-08-25 20:59:06 (673 days) | N/A |
 Evan | 2022-08-20 17:32:00 (678 days) | N/A |
| 76561198363461762 | 2022-08-15 18:05:57 (683 days) | N/A |
 ZBI PEEK-SKRT7 | 2022-08-08 08:33:02 (690 days) | N/A |
| 76561197986698529 | 2022-08-08 07:19:26 (690 days) | N/A |
 Vastator | 2022-08-07 17:29:22 (691 days) | N/A |
| 76561198140708361 | 2022-08-05 02:37:30 (693 days) | N/A |
 我是那串数字 | 2022-08-04 20:03:56 (694 days) | N/A |
 oxides of nitrogen | 2022-08-04 11:13:26 (694 days) | N/A |
 piXz | 2022-08-02 10:29:36 (696 days) | N/A |
 ☠🅻🅸🅻🅳🅰🆅🅸 | 2022-07-10 19:51:14 (719 days) | N/A |
 NonEmployed | 2022-07-10 15:09:30 (719 days) | N/A |
 totizera | 2022-07-10 12:48:39 (719 days) | N/A |
 andreesrull | 2022-07-03 11:29:37 (726 days) | N/A |
 BETANO | 2022-06-26 16:25:13 (733 days) | N/A |
 Average Music Producer | 2022-06-20 18:25:22 (739 days) | N/A |
| 76561199015084073 | 2022-06-18 11:40:06 (741 days) | N/A |
 ุ[Sourcebans MARK] | 2022-06-13 13:54:31 (746 days) | N/A |
 aafmjknn s;jknc | 2022-06-06 17:22:58 (753 days) | N/A |
| 76561198084754702 | 2022-05-27 09:58:52 (763 days) | N/A |
 Sanzio | 2022-05-07 18:56:42 (783 days) | N/A |
 OnionMuncher | 2022-05-07 14:04:47 (783 days) | N/A |
| 76561198839293064 | 2022-04-24 07:09:05 (796 days) | N/A |
 clay | 2022-04-14 06:25:18 (806 days) | N/A |
 L. | 2022-04-06 05:20:51 (814 days) | N/A |
| 76561199080439462 | 2022-03-29 16:40:06 (822 days) | N/A |
 BrocoliWarrior | 2022-03-16 11:57:48 (835 days) | N/A |
 K9 Kid | 2022-03-12 12:10:29 (839 days) | N/A |
 00000[Sourcebans MARK] | 2022-02-08 00:24:07 (871 days) | N/A |
 FYT ##RR##EFG | 2022-01-31 08:49:27 (879 days) | N/A |
 matheus tonathiu o PESADELO | 2021-12-21 21:22:09 (920 days) | N/A |
 Tjorben & Thorsen was here mos m | 2021-12-02 01:42:57 (939 days) | N/A |
| 76561198866688758 | 2021-10-04 16:44:14 (998 days) | N/A |
 zama1 | 2021-09-19 16:59:15 (1013 days) | N/A |
 kiesi | 2021-09-04 03:29:17 (1028 days) | N/A |
 orrit UMP-alumpa | 2021-08-25 13:15:25 (1038 days) | N/A |
 pe_ja | 2021-08-17 18:30:05 (1046 days) | N/A |
 !mdito Trading Skins | 2021-08-05 23:45:07 (1057 days) | N/A |
 spiido- | 2021-08-03 10:10:46 (1060 days) | N/A |
 Himawari™ | 2021-05-18 17:42:44 (1137 days) | N/A |
 kanade | 2021-05-17 07:17:09 (1138 days) | N/A |
 ☆손흥민 | 2021-05-06 18:45:13 (1149 days) | N/A |
 Leetify | 2021-04-22 15:02:31 (1163 days) | N/A |
| 76561198169358614 | 2021-04-14 05:56:14 (1171 days) | N/A |
 Д | 2021-02-16 15:00:05 (1228 days) | N/A |
| 76561198853960329 | 2021-01-29 10:45:14 (1246 days) | N/A |
 Gr1zzly | 2021-01-12 15:34:31 (1263 days) | N/A |
 kilaStar | 2020-12-29 12:01:38 (1277 days) | N/A |
 Dark | 2020-12-20 15:36:36 (1286 days) | N/A |
 Senju | 2020-12-18 02:50:59 (1288 days) | N/A |
| 76561197993381658 | 2020-12-14 08:31:42 (1292 days) | N/A |
 BoC | 2020-10-31 18:59:48 (1336 days) | N/A |
 Astro serioso | 2020-09-26 11:56:30 (1371 days) | N/A |
 tocxjo | 2020-09-07 14:31:39 (1390 days) | N/A |
| 76561199074967065 | 2020-08-31 13:20:26 (1397 days) | N/A |
| 76561199067252023 | 2020-08-31 13:18:45 (1397 days) | N/A |
 gever | 2020-08-22 12:40:36 (1406 days) | N/A |
 Groin son of Loin | 2020-08-22 12:26:37 (1406 days) | 2024-04-06 07:33:24 (83 days) |
 "I DESPISE BANANAS" | 2020-08-14 13:01:25 (1414 days) | N/A |
 Johnathan McAniston | 2020-07-28 10:55:52 (1431 days) | N/A |
| 76561199066727399 | 2020-06-14 12:57:59 (1475 days) | N/A |
| 76561198370502303 | 2020-05-15 11:22:57 (1505 days) | N/A |
 Nelex5000 | 2020-05-15 11:16:16 (1505 days) | N/A |
| 76561198326750952 | 2020-04-06 11:58:49 (1544 days) | N/A |
 Lady Noctowl | 2020-03-30 13:04:02 (1551 days) | N/A |
 Juley The Dinner Lady | 2019-09-07 12:20:09 (1756 days) | N/A |
| 76561198305860990 | 2019-07-31 16:03:18 (1794 days) | N/A |
| 76561198401722698 | 2018-11-01 14:01:41 (2066 days) | N/A |
 vintern | 2018-10-14 07:17:21 (2084 days) | N/A |
 Whitenova[Sourcebans MARK] | 2018-08-04 15:22:41 (2155 days) | N/A |
| 76561198311249248 | 2018-05-08 16:06:56 (2243 days) | N/A |
 due | 2018-05-02 07:31:37 (2249 days) | N/A |
| 76561198313159569 | 2018-04-30 04:33:49 (2251 days) | N/A |
| 76561198816362625 | 2018-02-22 11:04:43 (2318 days) | N/A |
| 76561198089405002 | 2018-02-18 09:21:03 (2322 days) | N/A |
| 76561198287589937 | 2017-08-11 10:39:34 (2513 days) | N/A |
| 76561198325854709 | 2017-08-05 10:24:16 (2519 days) | N/A |
 Lecs | 2017-07-03 16:08:53 (2552 days) | N/A |
| 76561198141243746 | 2017-01-04 10:26:43 (2732 days) | N/A |
 Spakzy | 2016-08-17 09:38:32 (2872 days) | N/A |
| 76561198122369083 | 2016-08-15 09:28:32 (2874 days) | N/A |
| 76561198084724473 | 2016-06-15 12:42:23 (2935 days) | N/A |
| 76561198132905633 | 2015-12-27 13:14:19 (3106 days) | N/A |
 ✪ Eggplant | 2015-12-25 17:36:54 (3108 days) | N/A |
 ALVILLO7220 | 2015-12-25 12:09:00 (3108 days) | N/A |
| 76561198137900217 | 2015-12-22 11:09:58 (3111 days) | N/A |
| 76561198121694190 | 2015-12-21 06:00:50 (3112 days) | N/A |
| 76561198209252735 | 2015-12-13 12:19:18 (3120 days) | N/A |